Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing cadA gene

Properties
Regulog: CadR-PbrR - Ralstonia
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator
Biological process: Lead resistance; Cadmium resistance
Effector: Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Phylum: Proteobacteria/Beta
Built upon 21 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Cupriavidus taiwanensis
Position: -61
Score: 6.40785
Sequence: ACTCTGTAGCCACTACAGGGT
Locus tag: RALTA_B1454
Name: cadA
Funciton: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
cadA -61 6.4 ACTCTGTAGCCACTACAGGGT RALTA_B1454
Ralstonia eutropha H16
Position: -61
Score: 6.40785
Sequence: ACTCTGTAGTCGCTACAGGGT
Locus tag: H16_B1644
Name: cadA
Funciton: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
cadA -61 6.4 ACTCTGTAGTCGCTACAGGGT H16_B1644
Ralstonia eutropha JMP134
Position: -61
Score: 6.2636
Sequence: ACTCTGTAGCGGCTACAGGGT
Locus tag: Reut_B3972
Name: cadA
Funciton: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
cadA -61 6.3 ACTCTGTAGCGGCTACAGGGT Reut_B3972
Ralstonia metallidurans CH34
Position: -46
Score: 6.06593
Sequence: ACCCTGTAGCGACTAAAGGGT
Locus tag: Rmet_4594
Name: cadA
Funciton: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
cadA -46 6.1 ACCCTGTAGCGACTAAAGGGT Rmet_4594
Ralstonia pickettii 12J
Position: -34
Score: 5.63839
Sequence: ACCCTGGAGCTTCTTCAGGGT
Locus tag: Rpic_4809
Name: cadA
Funciton: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
cadA -34 5.6 ACCCTGGAGCTTCTTCAGGGT Rpic_4809
Ralstonia solanacearum GMI1000
Position: -57
Score: 5.64595
Sequence: ACCCTGGAGTTCCTTCAGGGT
Locus tag: RS05448
Name: cadA
Funciton: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
cadA -57 5.6 ACCCTGGAGTTCCTTCAGGGT RS05448