Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing cadA gene

Properties
Regulog: CadR-PbrR - Shewanellaceae
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator
Biological process: Lead resistance; Cadmium resistance
Effector: Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Phylum: Proteobacteria/Gamma
Built upon 10 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Shewanella putrefaciens CN-32
Position: -59
Score: 6.35953
Sequence: ACTCTATAGTAACTACAGAGT
Locus tag: Sputcn32_1972
Name: czcD
Funciton: Co/Zn/Cd efflux protein
Locus tag: Sputcn32_1971
Name: null
Funciton: hypothetical protein
Locus tag: Sputcn32_1970
Name: czcC
Funciton: Heavy metal RND efflux outer membrane protein
Locus tag: Sputcn32_1969
Name: czcB
Funciton: Heavy metal efflux RND transporter, membrane fusion protein
Locus tag: Sputcn32_1968
Name: czcA
Funciton: Heavy metal efflux RND transmembrane protein
Locus tag: Sputcn32_1967
Name: null
Funciton: hypothetical protein
Locus tag: Sputcn32_1966
Name: cadA
Funciton: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
czcD-Sputcn32_1971-czcC-czcB-czcA-Sputcn32_1967-cadA -59 6.4 ACTCTATAGTAACTACAGAGT Sputcn32_1972