Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing lspA gene

Properties
Regulog: CadR-PbrR - Shewanellaceae
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator
Biological process: Lead resistance; Cadmium resistance
Effector: Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Phylum: Proteobacteria/Gamma
Built upon 10 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Shewanella frigidimarina NCIMB 400
Position: -61
Score: 5.84283
Sequence: ACTCTATAGTGACTATAGAGA
Locus tag: Sfri_3462
Name: cadA
Funciton: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
Locus tag: Sfri_3463
Name: lspA
Funciton: Lipoprotein signal peptidase (EC 3.4.23.36)
cadA-lspA -61 5.8 ACTCTATAGTGACTATAGAGA Sfri_3462