Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing lspA gene

Properties
Regulog: CadR-PbrR - Shewanellaceae
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator
Biological process: Lead resistance; Cadmium resistance
Effector: Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Phylum: Proteobacteria/Gamma
Built upon 10 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Shewanella putrefaciens CN-32
Position: -61
Score: 5.61753
Sequence: ACCTTATAGTGACTTTATAGT
Locus tag: Sputcn32_0195
Name: czcD2
Funciton: Co/Zn/Cd efflux protein
Locus tag: Sputcn32_0196
Name: lspA
Funciton: Lipoprotein signal peptidase (EC 3.4.23.36)
czcD2-lspA -61 5.6 ACCTTATAGTGACTTTATAGT Sputcn32_0195
Shewanella sp W3-18-1
Position: -61
Score: 5.61753
Sequence: ACCTTATAGTGACTTTATAGT
Locus tag: Sputw3181_0520
Name: czcD2
Funciton: Co/Zn/Cd efflux protein
Locus tag: Sputw3181_0519
Name: lspA
Funciton: Lipoprotein signal peptidase (EC 3.4.23.36)
czcD2-lspA -61 5.6 ACCTTATAGTGACTTTATAGT Sputw3181_0520