Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing groS gene

Properties
Regulog: HrcA - Caulobacterales
Regulator type: Transcription factor
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Phylum: Proteobacteria/alpha
Built upon 4 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Caulobacter crescentus CB15
Position: -86
Score: 7.10614
Sequence: TTGGCACTCGAATGGAGCGACTGCTAA
Locus tag: CC0686
Name: groS
Funciton: Heat shock protein 60 family co-chaperone GroES
Locus tag: CC0685
Name: groL
Funciton: Heat shock protein 60 family chaperone GroEL
groS-groL -86 7.1 TTGGCACTCGAATGGAGCGACTGCTAA CC0686
Caulobacter segnis ATCC 21756
Position: -87
Score: 7.30835
Sequence: TTAGCACTCGGAGGGAGCGACTGCTAA
Locus tag: Cseg_3693
Name: groS
Funciton: Heat shock protein 60 family co-chaperone GroES
Locus tag: Cseg_3694
Name: groL
Funciton: Heat shock protein 60 family chaperone GroEL
groS-groL -87 7.3 TTAGCACTCGGAGGGAGCGACTGCTAA Cseg_3693
Caulobacter sp. K31
Position: -88
Score: 7.39119
Sequence: TTGGCACTCGATGGGAGCGACTGCTAA
Locus tag: Caul_4151
Name: groS
Funciton: Heat shock protein 60 family co-chaperone GroES
Locus tag: Caul_4150
Name: groL
Funciton: Heat shock protein 60 family chaperone GroEL
groS-groL -88 7.4 TTGGCACTCGATGGGAGCGACTGCTAA Caul_4151
Phenylobacterium zucineum HLK1
Position: -93
Score: 6.90073
Sequence: TTAGCACTCAAGGGCCGAGACTGCTAA
Locus tag: PHZ_c3181
Name: groS
Funciton: Heat shock protein 60 family co-chaperone GroES
Locus tag: PHZ_c3182
Name: groL
Funciton: Heat shock protein 60 family chaperone GroEL
groS-groL -93 6.9 TTAGCACTCAAGGGCCGAGACTGCTAA PHZ_c3181