Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing rpoH gene

Properties
Regulog: HrcA - Comamonadaceae
Regulator type: Transcription factor
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Phylum: Proteobacteria/beta
Built upon 22 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Acidovorax avenae subsp. citrulli AAC00-1
Position: -57
Score: 6.54908
Sequence: TTAGCACTCCCTCCAAGAGACTGCTAA
Locus tag: Aave_3894
Name: rpoH
Funciton: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
rpoH -57 6.5 TTAGCACTCCCTCCAAGAGACTGCTAA Aave_3894
Acidovorax sp. JS42
Position: -28
Score: 6.97499
Sequence: TTAGCACTCTCTCCAATGGAGTGCTAA
Locus tag: Ajs_3522
Name: rpoH
Funciton: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
rpoH -28 7 TTAGCACTCTCTCCAATGGAGTGCTAA Ajs_3522
Comamonas testosteroni KF-1
Position: -28
Score: 6.83008
Sequence: TTAGCACTCTCTCTAACGGAGTGCTAA
Locus tag: CtesDRAFT_2864
Name: rpoH
Funciton: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
rpoH -28 6.8 TTAGCACTCTCTCTAACGGAGTGCTAA CtesDRAFT_2864
Delftia acidovorans SPH-1
Position: -57
Score: 6.99195
Sequence: TTAGCACTCGGTCATAACGAGTGCTAA
Locus tag: Daci_1694
Name: rpoH
Funciton: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
rpoH -57 7 TTAGCACTCGGTCATAACGAGTGCTAA Daci_1694
Leptothrix cholodnii SP-6
Position: -59
Score: 6.9416
Sequence: TTAGCACTCTCGAGGGTCGAGTGCTAA
Locus tag: Lcho_3542
Name: rpoH
Funciton: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
rpoH -59 6.9 TTAGCACTCTCGAGGGTCGAGTGCTAA Lcho_3542
Methylibium petroleiphilum PM1
Position: -54
Score: 7.17409
Sequence: TTAGCACTCGTTTTACGTGAGTGCTAA
Locus tag: Mpe_A3171
Name: rpoH
Funciton: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
rpoH -54 7.2 TTAGCACTCGTTTTACGTGAGTGCTAA Mpe_A3171
Polaromonas naphthalenivorans CJ2
Position: -57
Score: 6.00645
Sequence: CTGGCACTCTCTCTGATGGAGTGCTAA
Locus tag: Pnap_0889
Name: rpoH
Funciton: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
rpoH -57 6 CTGGCACTCTCTCTGATGGAGTGCTAA Pnap_0889
Polaromonas sp. JS666
Position: -57
Score: 6.97499
Sequence: TTAGCACTCTCTCCAATGGAGTGCTAA
Locus tag: Bpro_1256
Name: rpoH
Funciton: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
rpoH -57 7 TTAGCACTCTCTCCAATGGAGTGCTAA Bpro_1256
Rhodoferax ferrireducens DSM 15236
Position: -58
Score: 7.13299
Sequence: TTAGCACTCTCTCTCATAGAGTGCTAA
Locus tag: Rfer_1692
Name: rpoH
Funciton: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
rpoH -58 7.1 TTAGCACTCTCTCTCATAGAGTGCTAA Rfer_1692
Variovorax paradoxus S110
Position: -55
Score: 6.91404
Sequence: TTAGCACTCCCTCCAATCGAGTGCTAA
Locus tag: Vapar_4379
Name: rpoH
Funciton: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
rpoH -55 6.9 TTAGCACTCCCTCCAATCGAGTGCTAA Vapar_4379
Verminephrobacter eiseniae EF01-2
Position: -72
Score: 6.60359
Sequence: TTGGCACTCGATCGCAGAGAGTGCTAA
Locus tag: Veis_4476
Name: rpoH
Funciton: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
rpoH -72 6.6 TTGGCACTCGATCGCAGAGAGTGCTAA Veis_4476