Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing groS gene

Properties
Regulog: HrcA - Comamonadaceae
Regulator type: Transcription factor
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Phylum: Proteobacteria/beta
Built upon 22 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Acidovorax avenae subsp. citrulli AAC00-1
Position: -123
Score: 6.92309
Sequence: TTAGCACTCGAAGCGGACGAGTGCTAA
Locus tag: Aave_0946
Name: groS
Funciton: Heat shock protein 60 family co-chaperone GroES
Locus tag: Aave_0945
Name: groL
Funciton: Heat shock protein 60 family chaperone GroEL
groS-groL -123 6.9 TTAGCACTCGAAGCGGACGAGTGCTAA Aave_0946
Acidovorax sp. JS42
Position: -112
Score: 7.20358
Sequence: TTAGCACTCGAAACAGATGAGTGCTAA
Locus tag: Ajs_0700
Name: groS
Funciton: Heat shock protein 60 family co-chaperone GroES
Locus tag: Ajs_0699
Name: groL
Funciton: Heat shock protein 60 family chaperone GroEL
groS-groL -112 7.2 TTAGCACTCGAAACAGATGAGTGCTAA Ajs_0700
Comamonas testosteroni KF-1
Position: -111
Score: 7.02817
Sequence: TTAGCACTCAATGGGGTTGAGTGCTAA
Locus tag: CtesDRAFT_4575
Name: groS
Funciton: Heat shock protein 60 family co-chaperone GroES
Locus tag: CtesDRAFT_4574
Name: groL
Funciton: Heat shock protein 60 family chaperone GroEL
groS-groL -111 7 TTAGCACTCAATGGGGTTGAGTGCTAA CtesDRAFT_4575
Delftia acidovorans SPH-1
Position: -114
Score: 6.95003
Sequence: TTAGCACTCGTTGGGCATGAGTGCTAA
Locus tag: Daci_5660
Name: groS
Funciton: Heat shock protein 60 family co-chaperone GroES
Locus tag: Daci_5661
Name: groL
Funciton: Heat shock protein 60 family chaperone GroEL
groS-groL -114 7 TTAGCACTCGTTGGGCATGAGTGCTAA Daci_5660
Leptothrix cholodnii SP-6
Position: -96
Score: 6.46445
Sequence: TTAGCACTCGCCGGTGGTGAGTGCTAG
Locus tag: Lcho_0482
Name: groS
Funciton: Heat shock protein 60 family co-chaperone GroES
Locus tag: Lcho_0483
Name: groL
Funciton: Heat shock protein 60 family chaperone GroEL
groS-groL -96 6.5 TTAGCACTCGCCGGTGGTGAGTGCTAG Lcho_0482
Methylibium petroleiphilum PM1
Position: -129
Score: 6.26404
Sequence: CTAGCACTCGCGCAGACTGAGTGCTAA
Locus tag: Mpe_A0427
Name: groS
Funciton: Heat shock protein 60 family co-chaperone GroES
Locus tag: Mpe_A0428
Name: groL
Funciton: Heat shock protein 60 family chaperone GroEL
groS-groL -129 6.3 CTAGCACTCGCGCAGACTGAGTGCTAA Mpe_A0427
Polaromonas naphthalenivorans CJ2
Position: -134
Score: 6.83068
Sequence: TTAGCACTCGATGAGGTGGAGTGCTAA
Locus tag: Pnap_0658
Name: groS
Funciton: Heat shock protein 60 family co-chaperone GroES
Locus tag: Pnap_0657
Name: groL
Funciton: Heat shock protein 60 family chaperone GroEL
groS-groL -134 6.8 TTAGCACTCGATGAGGTGGAGTGCTAA Pnap_0658
Polaromonas sp. JS666
Position: -121
Score: 7.19711
Sequence: TTAGCACTCGATGGTATTGAGTGCTAA
Locus tag: Bpro_0760
Name: groS
Funciton: Heat shock protein 60 family co-chaperone GroES
Locus tag: Bpro_0759
Name: groL
Funciton: Heat shock protein 60 family chaperone GroEL
groS-groL -121 7.2 TTAGCACTCGATGGTATTGAGTGCTAA Bpro_0760
Rhodoferax ferrireducens DSM 15236
Position: -130
Score: 7.20358
Sequence: TTAGCACTCGTAAGAGTTGAGTGCTAA
Locus tag: Rfer_1132
Name: groS
Funciton: Heat shock protein 60 family co-chaperone GroES
Locus tag: Rfer_1131
Name: groL
Funciton: Heat shock protein 60 family chaperone GroEL
groS-groL -130 7.2 TTAGCACTCGTAAGAGTTGAGTGCTAA Rfer_1132
Variovorax paradoxus S110
Position: -110
Score: 7.021
Sequence: TTAGCACTCGCTGCTGACGAGTGCTAA
Locus tag: Vapar_1119
Name: groS
Funciton: Heat shock protein 60 family co-chaperone GroES
Locus tag: Vapar_1118
Name: groL
Funciton: Heat shock protein 60 family chaperone GroEL
groS-groL -110 7 TTAGCACTCGCTGCTGACGAGTGCTAA Vapar_1119
Verminephrobacter eiseniae EF01-2
Position: -110
Score: 6.78183
Sequence: TTAGCACTCTCCGCTGGGGAGTGCTAA
Locus tag: Veis_2566
Name: groS
Funciton: Heat shock protein 60 family co-chaperone GroES
Locus tag: Veis_2567
Name: groL
Funciton: Heat shock protein 60 family chaperone GroEL
groS-groL -110 6.8 TTAGCACTCTCCGCTGGGGAGTGCTAA Veis_2566