Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing RL3685 gene

Properties
Regulog: AglR - Rhizobiales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Alpha-glucosides utilization
Effector: Alpha-glucoside; Maltose; Trehalose; Sucrose
Phylum: Proteobacteria/Alpha
Built upon 24 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Rhizobium leguminosarum bv. viciae 3841
Position: -66
Score: 6.20772
Sequence: TTTCCAAAGCGCTTTGAATC
Locus tag: RL3686
Name: thuA
Funciton: Trehalose utilization protein
Locus tag: RL3685
Name: null
Funciton: Oxidoreductase (EC 1.1.1.-)
thuA-RL3685 -66 6.2 TTTCCAAAGCGCTTTGAATC RL3686