Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing aglK gene

Regulog: AglR - Rhizobiales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Alpha-glucosides utilization
Effector: Alpha-glucoside; Maltose; Trehalose; Sucrose
Phylum: Proteobacteria/Alpha
Built upon 24 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Agrobacterium tumefaciens str. C58 (Cereon)
Position: -221
Score: 5.50016
Position: -64
Score: 6.07398
Locus tag: Atu0591
Name: aglE
Funciton: Alpha-glucoside ABC transporter periplasmic sugar-binding protein
Locus tag: Atu0592
Name: aglF
Funciton: Alpha-glucoside ABC transporter permease protein
Locus tag: Atu0593
Name: aglG
Funciton: Alpha-glucoside ABC transporter permease protein
Locus tag: Atu0594
Name: aglA
Funciton: Alpha-glucosidase AglA
Locus tag: Atu0595
Name: aglK
Funciton: Alpha-glucoside transport ATP-binding protein AglK
aglE-aglF-aglG-aglA-aglK -221 5.5 TTCCCAAAGCGCTTTAGATT Atu0591
Mesorhizobium loti MAFF303099
Position: -138
Score: 6.16376
Locus tag: mll5113
Name: aglE
Funciton: Alpha-glucoside ABC transporter periplasmic sugar-binding protein
Locus tag: mll5112
Name: aglF
Funciton: Alpha-glucoside ABC transporter permease protein
Locus tag: mll5110
Name: aglG
Funciton: Alpha-glucoside ABC transporter permease protein
Locus tag: mll5109
Name: aglA
Funciton: Alpha-glucosidase AglA
Locus tag: mll5107
Name: aglK
Funciton: Alpha-glucoside transport ATP-binding protein AglK
aglE-aglF-aglG-aglA-aglK -138 6.2 AAGCCAAAGCGCTTTGGAAG mll5113
Mesorhizobium sp. BNC1
Position: -105
Score: 6.16259
Locus tag: Meso_2855
Name: aglE
Funciton: Alpha-glucoside ABC transporter periplasmic sugar-binding protein
Locus tag: Meso_2856
Name: aglF
Funciton: Alpha-glucoside ABC transporter permease protein
Locus tag: Meso_2857
Name: aglG
Funciton: Alpha-glucoside ABC transporter permease protein
Locus tag: Meso_2858
Name: aglK
Funciton: Alpha-glucoside transport ATP-binding protein AglK
aglE-aglF-aglG-aglK -105 6.2 TTCTCAAAGCGCTTTGAGCT Meso_2855
Rhizobium etli CFN 42
Position: -236
Score: 5.74227
Position: -73
Score: 6.41074
Locus tag: RHE_CH00696
Name: aglE
Funciton: Alpha-glucoside ABC transporter periplasmic sugar-binding protein
Locus tag: RHE_CH00697
Name: aglF
Funciton: Alpha-glucoside ABC transporter permease protein
Locus tag: RHE_CH00698
Name: aglG
Funciton: Alpha-glucoside ABC transporter permease protein
Locus tag: RHE_CH00699
Name: aglA
Funciton: Alpha-glucosidase AglA
Locus tag: RHE_CH00700
Name: aglK
Funciton: Alpha-glucoside transport ATP-binding protein AglK
aglE-aglF-aglG-aglA-aglK -236 5.7 CGCTCAAAGCGCTTTTAATT RHE_CH00696
Rhizobium leguminosarum bv. viciae 3841
Position: -245
Score: 5.86075
Position: -73
Score: 6.25159
Locus tag: RL0745
Name: aglE
Funciton: Alpha-glucoside ABC transporter periplasmic sugar-binding protein
Locus tag: RL0746
Name: aglF
Funciton: Alpha-glucoside ABC transporter permease protein
Locus tag: RL0747
Name: aglG
Funciton: Alpha-glucoside ABC transporter permease protein
Locus tag: RL0748
Name: aglA
Funciton: Alpha-glucosidase AglA
Locus tag: RL0749
Name: aglK
Funciton: Alpha-glucoside transport ATP-binding protein AglK
aglE-aglF-aglG-aglA-aglK -245 5.9 CATCCAAAGCGCTTTCAATT RL0745
Rhizobium sp. NGR234
Position: -83
Score: 6.53738
Locus tag: NGR_c03100
Name: aglE
Funciton: Alpha-glucoside ABC transporter periplasmic sugar-binding protein
Locus tag: NGR_c03110
Name: aglF
Funciton: Alpha-glucoside ABC transporter permease protein
Locus tag: NGR_c03120
Name: aglG
Funciton: Alpha-glucoside ABC transporter permease protein
Locus tag: NGR_c03130
Name: aglA
Funciton: Alpha-glucosidase AglA
Locus tag: NGR_c03140
Name: aglK
Funciton: Alpha-glucoside transport ATP-binding protein AglK
aglE-aglF-aglG-aglA-aglK -83 6.5 AACTCAAAGCGCTTTGAATA NGR_c03100
Sinorhizobium meliloti 1021
Position: -104
Score: 6.56409
Locus tag: SMc03061
Name: aglE
Funciton: Alpha-glucoside ABC transporter periplasmic sugar-binding protein
Locus tag: SMc03062
Name: aglF
Funciton: Alpha-glucoside ABC transporter permease protein
Locus tag: SMc03063
Name: aglG
Funciton: Alpha-glucoside ABC transporter permease protein
Locus tag: SMc03064
Name: aglA
Funciton: Alpha-glucosidase AglA
Locus tag: SMc03065
Name: aglK
Funciton: Alpha-glucoside transport ATP-binding protein AglK
aglE-aglF-aglG-aglA-aglK -104 6.6 AACTCAAAGCGCTTTGAATG SMc03061