Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing aglR gene

Properties
Regulog: AglR - Rhizobiales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Alpha-glucosides utilization
Effector: Alpha-glucoside; Maltose; Trehalose; Sucrose
Phylum: Proteobacteria/Alpha
Built upon 24 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Agrobacterium tumefaciens str. C58 (Cereon)
Position: -233
Score: 6.07398
Sequence: CAATCAAAGCGCTTTGGCTA
Position: -76
Score: 5.50016
Sequence: AATCTAAAGCGCTTTGGGAA
Locus tag: Atu0590
Name: aglR
Funciton: Transcriptional regulator of alpha-glucoside utilization, LacI family
aglR -233 6.1 CAATCAAAGCGCTTTGGCTA Atu0590
-76 5.5 AATCTAAAGCGCTTTGGGAA
Mesorhizobium loti MAFF303099
Position: -240
Score: 6.16376
Sequence: CTTCCAAAGCGCTTTGGCTT
Position: -21
Score: 5.4071
Sequence: ATTTAAAAGCGCTTTGAGGG
Locus tag: mlr5115
Name: aglR
Funciton: Transcriptional regulator of alpha-glucoside utilization, LacI family
aglR -240 6.2 CTTCCAAAGCGCTTTGGCTT mlr5115
-21 5.4 ATTTAAAAGCGCTTTGAGGG
Mesorhizobium sp. BNC1
Position: -127
Score: 6.16259
Sequence: AGCTCAAAGCGCTTTGAGAA
Locus tag: Meso_2854
Name: aglR
Funciton: Transcriptional regulator of alpha-glucoside utilization, LacI family
aglR -127 6.2 AGCTCAAAGCGCTTTGAGAA Meso_2854
Rhizobium etli CFN 42
Position: -244
Score: 6.41074
Sequence: ATTTCAAAGCGCTTTGACAC
Position: -81
Score: 5.74227
Sequence: AATTAAAAGCGCTTTGAGCG
Locus tag: RHE_CH00695
Name: aglR
Funciton: Transcriptional regulator of alpha-glucoside utilization, LacI family
aglR -244 6.4 ATTTCAAAGCGCTTTGACAC RHE_CH00695
-81 5.7 AATTAAAAGCGCTTTGAGCG
Rhizobium leguminosarum bv. viciae 3841
Position: -256
Score: 6.25159
Sequence: ATTTCAAAGCGCTTTGACCC
Position: -84
Score: 5.86075
Sequence: AATTGAAAGCGCTTTGGATG
Locus tag: RL0744
Name: aglR
Funciton: Transcriptional regulator of alpha-glucoside utilization, LacI family
aglR -256 6.3 ATTTCAAAGCGCTTTGACCC RL0744
-84 5.9 AATTGAAAGCGCTTTGGATG
Rhizobium sp. NGR234
Position: -235
Score: 6.53738
Sequence: TATTCAAAGCGCTTTGAGTT
Position: -30
Score: 6.18867
Sequence: TATCCAAAGCGCTTTGAGAG
Locus tag: NGR_c03090
Name: aglR
Funciton: Transcriptional regulator of alpha-glucoside utilization, LacI family
aglR -235 6.5 TATTCAAAGCGCTTTGAGTT NGR_c03090
-30 6.2 TATCCAAAGCGCTTTGAGAG
Sinorhizobium meliloti 1021
Position: -233
Score: 6.56409
Sequence: CATTCAAAGCGCTTTGAGTT
Position: -30
Score: 6.26624
Sequence: TATTCAAAGCGCTTTGGAAG
Locus tag: SMc03060
Name: aglR
Funciton: Transcriptional regulator of alpha-glucoside utilization, LacI family
aglR -233 6.6 CATTCAAAGCGCTTTGAGTT SMc03060
-30 6.3 TATTCAAAGCGCTTTGGAAG