Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing Dret_0354 gene

Properties
Regulog: DVU0309 - Desulfovibrionales
Regulator type: Transcription factor
Regulator family: LysR
Regulation mode:
Biological process:
Effector:
Phylum: Proteobacteria/delta
Built upon 14 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Desulfohalobium retbaense DSM 5692
Position: -184
Score: 5.34443
Sequence: CCTATCAGAAATTTTGATAGC
Locus tag: Dret_0354
Name: null
Funciton: peptidase M24
Dret_0354 -184 5.3 CCTATCAGAAATTTTGATAGC Dret_0354