Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing COG4125 gene

Properties
Regulog: DVU0309 - Desulfovibrionales
Regulator type: Transcription factor
Regulator family: LysR
Regulation mode:
Biological process:
Effector:
Phylum: Proteobacteria/delta
Built upon 14 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Desulfovibrio desulfuricans G20
Position: -246
Score: 5.70836
Sequence: TCTATCACAAAATTAGATAGA
Position: -213
Score: 4.38809
Sequence: ACCCTCACTCAATGTGATAGT
Locus tag: Dde_0348
Name: COG4125
Funciton: membrane protein, putative
COG4125 -246 5.7 TCTATCACAAAATTAGATAGA Dde_0348
-213 4.4 ACCCTCACTCAATGTGATAGT
Desulfovibrio vulgaris Hildenborough
Position: -85
Score: 5.73734
Sequence: TCCATCTGTTTTTCAGATAGA
Position: -52
Score: 5.12407
Sequence: TCAATCCGTCTTCCAGATAGA
Locus tag: DVU0308
Name: COG4125
Funciton: membrane protein, putative
COG4125 -85 5.7 TCCATCTGTTTTTCAGATAGA DVU0308
-52 5.1 TCAATCCGTCTTCCAGATAGA