Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing DVU0309 gene

Properties
Regulog: DVU0309 - Desulfovibrionales
Regulator type: Transcription factor
Regulator family: LysR
Regulation mode:
Biological process:
Effector:
Phylum: Proteobacteria/delta
Built upon 14 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Desulfohalobium retbaense DSM 5692
Position: -418
Score: 5.34443
Sequence: GCTATCAAAATTTCTGATAGG
Locus tag: Dret_0355
Name: null
Funciton: transcriptional regulator, LysR family
Dret_0355 -418 5.3 GCTATCAAAATTTCTGATAGG Dret_0355
Desulfovibrio desulfuricans G20
Position: -67
Score: 4.38809
Sequence: ACTATCACATTGAGTGAGGGT
Position: -34
Score: 5.70836
Sequence: TCTATCTAATTTTGTGATAGA
Locus tag: Dde_0349
Name: null
Funciton: transcriptional regulator, LysR family
Dde_0349 -67 4.4 ACTATCACATTGAGTGAGGGT Dde_0349
-34 5.7 TCTATCTAATTTTGTGATAGA
Desulfovibrio salexigens DSM 2638
Position: -63
Score: 5.03099
Sequence: TCAATCTTTTATTCAGTTTGG
Position: -31
Score: 5.19883
Sequence: ACAATCTTAAAACAAGATAGG
Locus tag: Desal_3366
Name: null
Funciton: transcriptional regulator, LysR family
Desal_3366 -63 5 TCAATCTTTTATTCAGTTTGG Desal_3366
-31 5.2 ACAATCTTAAAACAAGATAGG
Desulfovibrio vulgaris Hildenborough
Position: -61
Score: 5.12407
Sequence: TCTATCTGGAAGACGGATTGA
Position: -28
Score: 5.73734
Sequence: TCTATCTGAAAAACAGATGGA
Locus tag: DVU0309
Name: null
Funciton: transcriptional regulator, LysR family
DVU0309 -61 5.1 TCTATCTGGAAGACGGATTGA DVU0309
-28 5.7 TCTATCTGAAAAACAGATGGA