Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing Haur_1418 gene

Properties
Regulog: Caur_1157 - Chloroflexia
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Beta-glucosides utilization
Effector: Beta-glucoside
Phylum: Chloroflexi
Built upon 7 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Herpetosiphon aurantiacus ATCC 23779
Position: -41
Score: 5.21538
Sequence: TATTGAGACCGATTCCAATG
Locus tag: Haur_1418
Name: null
Funciton: Cellulose 1,4-beta-cellobiosidase precursor (EC 3.2.1.91)
Haur_1418 -41 5.2 TATTGAGACCGATTCCAATG Haur_1418