Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing bglA gene

Regulog: Caur_1157 - Chloroflexia
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Beta-glucosides utilization
Effector: Beta-glucoside
Phylum: Chloroflexi
Built upon 7 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Herpetosiphon aurantiacus ATCC 23779
Position: -207
Score: 5.69641
Position: -131
Score: 6.03787
Locus tag: Haur_0296
Name: bglA
Funciton: Endoglucanase B precursor (EC (Endo-1,4-beta-glucanase B) (Cellulase B)
Locus tag: Haur_0295
Name: null
Funciton: Endoglucanase A precursor (EC (Endo-1,4-beta-glucanase A) (Cellulase A)
Locus tag: Haur_0294
Name: null
Funciton: Endoglucanase 2 precursor (EC (Endo-1,4-beta-glucanase 2) (Cellulase 2)
Locus tag: Haur_0293
Name: null
Funciton: Endoglucanase 2 precursor (EC (Endo-1,4-beta-glucanase 2) (Cellulase 2)
bglA-Haur_0295-Haur_0294-Haur_0293 -207 5.7 GCTTGGGAGCGATCTCATTC Haur_0296