Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing Haur_0300 gene

Regulog: Caur_1157 - Chloroflexia
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Beta-glucosides utilization
Effector: Beta-glucoside
Phylum: Chloroflexi
Built upon 7 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Herpetosiphon aurantiacus ATCC 23779
Position: -347
Score: 6.03787
Position: -271
Score: 5.69641
Locus tag: Haur_0297
Name: Caur_1157
Funciton: Predicted transcriptional regulator for beta-glucoside utilization, LacI family
Locus tag: Haur_0298
Name: Haur_0298
Funciton: Sugar ABC transport system, sugar-binding protein
Locus tag: Haur_0299
Name: null
Funciton: Sugar ABC transporter permease
Locus tag: Haur_0300
Name: Haur_0300
Funciton: binding-protein-dependent transport systems inner membrane component
Locus tag: Haur_0301
Name: null
Funciton: hypothetical protein
Caur_1157-Haur_0298-Haur_0299-Haur_0300-Haur_0301 -347 6 CATTGAGACCGCTCCCAATG Haur_0297