Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing Caur_1157 gene

Regulog: Caur_1157 - Chloroflexia
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Beta-glucosides utilization
Effector: Beta-glucoside
Phylum: Chloroflexi
Built upon 7 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Chloroflexus aggregans DSM 9485
Position: -119
Score: 5.57077
Locus tag: Cagg_1685
Name: Caur_1157
Funciton: Predicted transcriptional regulator for beta-glucoside utilization, LacI family
Locus tag: Cagg_1686
Name: null
Funciton: extracellular solute-binding protein family 1
Locus tag: Cagg_1687
Name: null
Funciton: binding-protein-dependent transport systems inner membrane component
Locus tag: Cagg_1688
Name: null
Funciton: binding-protein-dependent transport systems inner membrane component
Locus tag: Cagg_1689
Name: null
Funciton: glycoside hydrolase family 3 domain protein
Locus tag: Cagg_1690
Name: null
Funciton: glycoside hydrolase family 16
Locus tag: Cagg_1691
Name: bglB
Funciton: Beta-glucosidase (EC
Caur_1157-Cagg_1686-Cagg_1687-Cagg_1688-Cagg_1689-Cagg_1690-bglB -119 5.6 CCCTGGAAGCGCTTTCACGG Cagg_1685
Chloroflexus sp. Y-400-fl
Position: -117
Score: 5.57077
Locus tag: Chy400_1181
Name: Caur_1157
Funciton: Predicted transcriptional regulator for beta-glucoside utilization, LacI family
Locus tag: Chy400_1180
Name: null
Funciton: extracellular solute-binding protein family 1
Locus tag: Chy400_1179
Name: null
Funciton: binding-protein-dependent transport systems inner membrane component
Locus tag: Chy400_1178
Name: null
Funciton: binding-protein-dependent transport systems inner membrane component
Locus tag: Chy400_1177
Name: null
Funciton: glycoside hydrolase family 3 domain protein
Locus tag: Chy400_1176
Name: null
Funciton: glycoside hydrolase family 16
Locus tag: Chy400_1175
Name: bglB
Funciton: Beta-glucosidase (EC
Caur_1157-Chy400_1180-Chy400_1179-Chy400_1178-Chy400_1177-Chy400_1176-bglB -117 5.6 GACTGGAAGCGCTTTCACGG Chy400_1181
Herpetosiphon aurantiacus ATCC 23779
Position: -347
Score: 6.03787
Position: -271
Score: 5.69641
Locus tag: Haur_0297
Name: Caur_1157
Funciton: Predicted transcriptional regulator for beta-glucoside utilization, LacI family
Locus tag: Haur_0298
Name: Haur_0298
Funciton: Sugar ABC transport system, sugar-binding protein
Locus tag: Haur_0299
Name: null
Funciton: Sugar ABC transporter permease
Locus tag: Haur_0300
Name: Haur_0300
Funciton: binding-protein-dependent transport systems inner membrane component
Locus tag: Haur_0301
Name: null
Funciton: hypothetical protein
Caur_1157-Haur_0298-Haur_0299-Haur_0300-Haur_0301 -347 6 CATTGAGACCGCTCCCAATG Haur_0297