Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing copZ gene

Properties
Regulog: FlpA - Streptococcaceae
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: activator (repressor)
Biological process: Heavy metal resistance
Effector: Oxygen
Phylum: Firmicutes
Built upon 4 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Lactococcus lactis subsp. cremoris SK11
Position: -76
Score: 6.02079
Sequence: TAATTGATACAAATCAATTT
Locus tag: LACR_1043
Name: copZ
Funciton: Copper chaperone
Locus tag: LACR_1044
Name: dps
Funciton: Non-specific DNA-binding protein Dps / Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1)
Locus tag: LACR_1045
Name: flpA
Funciton: Heavy metal resistance transcriptional regulator FlpA, Crp family
copZ-dps-flpA -76 6 TAATTGATACAAATCAATTT LACR_1043
Lactococcus lactis subsp. lactis Il1403
Position: -88
Score: 5.71454
Sequence: TTCTTGATGTAAATCAATGT
Locus tag: L134080
Name: copZ
Funciton: Copper chaperone
copZ -88 5.7 TTCTTGATGTAAATCAATGT L134080