Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing clpC gene

Properties
Regulog: CtsR - Lactobacillaceae
Regulator type: Transcription factor
Regulator family: CtsR
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Phylum: Firmicutes
Built upon 44 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Lactobacillus brevis ATCC 367
Position: -45
Score: -1.08473
Sequence: TTAGTCAGCATTAGTCAAATAAGT
Locus tag: LVIS_1701
Name: ctsR
Funciton: Stress and heat shock response transcriptional regulator CtsR, CtsR family
Locus tag: LVIS_1700
Name: clpC
Funciton: ATP-dependent Clp protease ATP-binding subunit ClpC
ctsR-clpC -45 -1.1 TTAGTCAGCATTAGTCAAATAAGT LVIS_1701
Lactobacillus casei ATCC 334
Position: -39
Score: -0.0397677
Sequence: ATAGTCAAGATTGGTCAAAGTCAA
Locus tag: LSEI_2518
Name: ctsR
Funciton: Stress and heat shock response transcriptional regulator CtsR, CtsR family
Locus tag: LSEI_2517
Name: clpC
Funciton: ATP-dependent Clp protease ATP-binding subunit ClpC
ctsR-clpC -39 -0 ATAGTCAAGATTGGTCAAAGTCAA LSEI_2518
Lactobacillus plantarum WCFS1
Position: -41
Score: -0.277144
Sequence: ATAGTCAATATTAGTCAAAGATAA
Locus tag: lp_1018
Name: ctsR
Funciton: Stress and heat shock response transcriptional regulator CtsR, CtsR family
Locus tag: lp_1019
Name: clpC
Funciton: ATP-dependent Clp protease ATP-binding subunit ClpC
ctsR-clpC -41 -0.3 ATAGTCAATATTAGTCAAAGATAA lp_1018
Lactobacillus rhamnosus GG
Position: -39
Score: -0.0397677
Sequence: ATAGTCAAGATTGGTCAAAGTCAA
Locus tag: LGG_02500
Name: ctsR
Funciton: Stress and heat shock response transcriptional regulator CtsR, CtsR family
Locus tag: LGG_02499
Name: clpC
Funciton: ATP-dependent Clp protease ATP-binding subunit ClpC
ctsR-clpC -39 -0 ATAGTCAAGATTGGTCAAAGTCAA LGG_02500
Lactobacillus sakei subsp. sakei 23K
Position: -77
Score: -0.816409
Sequence: ATAGTCAACGTTAGTCAAAGTTAA
Locus tag: LSA1780
Name: ctsR
Funciton: Stress and heat shock response transcriptional regulator CtsR, CtsR family
Locus tag: LSA1779
Name: clpC
Funciton: ATP-dependent Clp protease ATP-binding subunit ClpC
ctsR-clpC -77 -0.8 ATAGTCAACGTTAGTCAAAGTTAA LSA1780
Lactobacillus salivarius subsp. salivarius UCC118
Position: -42
Score: -0.958259
Sequence: AAAGTCAATGTAGGTCAAACCTAC
Locus tag: LSL_0195
Name: ctsR
Funciton: Stress and heat shock response transcriptional regulator CtsR, CtsR family
Locus tag: LSL_0196
Name: clpC
Funciton: ATP-dependent Clp protease ATP-binding subunit ClpC
ctsR-clpC -42 -1 AAAGTCAATGTAGGTCAAACCTAC LSL_0195
Oenococcus oeni PSU-1
Position: -21
Score: -0.891367
Sequence: TTAGTCAGGAATGGTCAAATTATG
Locus tag: OEOE_0513
Name: ctsR
Funciton: Stress and heat shock response transcriptional regulator CtsR, CtsR family
Locus tag: OEOE_0514
Name: clpC
Funciton: ATP-dependent Clp protease ATP-binding subunit ClpC
ctsR-clpC -21 -0.9 TTAGTCAGGAATGGTCAAATTATG OEOE_0513
Pediococcus pentosaceus ATCC 25745
Position: -38
Score: -0.616609
Sequence: ATAGTCAACATTAGTCAGAGTATA
Locus tag: PEPE_1428
Name: ctsR
Funciton: Stress and heat shock response transcriptional regulator CtsR, CtsR family
Locus tag: PEPE_1427
Name: clpC
Funciton: ATP-dependent Clp protease ATP-binding subunit ClpC
ctsR-clpC -38 -0.6 ATAGTCAACATTAGTCAGAGTATA PEPE_1428