Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing groL gene

Properties
Regulog: CtsR - Lactobacillaceae
Regulator type: Transcription factor
Regulator family: CtsR
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Phylum: Firmicutes
Built upon 44 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Lactobacillus fermentum IFO 3956
Position: -153
Score: -0.638308
Sequence: TTGGTCAAAATTAGTCAAAGTTTT
Locus tag: LAF_0325
Name: groS
Funciton: Heat shock protein 60 family co-chaperone GroES
Locus tag: LAF_0326
Name: groL
Funciton: Heat shock protein 60 family chaperone GroEL
groS-groL -153 -0.6 TTGGTCAAAATTAGTCAAAGTTTT LAF_0325
Lactobacillus reuteri JCM 1112
Position: -128
Score: -1.14175
Sequence: ATGGTCAAAAAAAGTCAAAGTGTT
Locus tag: LAR_0342
Name: groS
Funciton: Heat shock protein 60 family co-chaperone GroES
Locus tag: LAR_0343
Name: groL
Funciton: Heat shock protein 60 family chaperone GroEL
groS-groL -128 -1.1 ATGGTCAAAAAAAGTCAAAGTGTT LAR_0342
Oenococcus oeni PSU-1
Position: -72
Score: 6.71498
Sequence: AAAAGTTTGACCTTTTTTGACCAA
Locus tag: OEOE_1397
Name: groS
Funciton: Heat shock protein 60 family co-chaperone GroES
Locus tag: OEOE_1396
Name: groL
Funciton: Heat shock protein 60 family chaperone GroEL
groS-groL -72 6.7 AAAAGTTTGACCTTTTTTGACCAA OEOE_1397
Pediococcus pentosaceus ATCC 25745
Position: -128
Score: -0.872603
Sequence: TTGGTTAATAAAGGTCAAAAATAC
Locus tag: PEPE_0420
Name: groS
Funciton: Heat shock protein 60 family co-chaperone GroES
Locus tag: PEPE_0421
Name: groL
Funciton: Heat shock protein 60 family chaperone GroEL
groS-groL -128 -0.9 TTGGTTAATAAAGGTCAAAAATAC PEPE_0420