Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing clpE gene

Properties
Regulog: CtsR - Lactobacillaceae
Regulator type: Transcription factor
Regulator family: CtsR
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Phylum: Firmicutes
Built upon 44 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Lactobacillus brevis ATCC 367
Position: -84
Score: 0.606989
Sequence: ATGGTCAAGAAAGGTCAAGCCTTT
Locus tag: LVIS_1554
Name: clpE
Funciton: ATP-dependent Clp protease, ATP-binding subunit ClpE
clpE -84 0.6 ATGGTCAAGAAAGGTCAAGCCTTT LVIS_1554
Lactobacillus casei ATCC 334
Position: -198
Score: 0.0981333
Sequence: TAGGTCAAGAAAGGTCAAACCTTT
Locus tag: LSEI_1762
Name: clpE
Funciton: ATP-dependent Clp protease, ATP-binding subunit ClpE
clpE -198 0.1 TAGGTCAAGAAAGGTCAAACCTTT LSEI_1762
Lactobacillus fermentum IFO 3956
Position: -48
Score: -0.667882
Sequence: ATGGTCAAGAAAAGTCAAAGGTTG
Locus tag: LAF_1388
Name: clpE
Funciton: ATP-dependent Clp protease, ATP-binding subunit ClpE
clpE -48 -0.7 ATGGTCAAGAAAAGTCAAAGGTTG LAF_1388
Lactobacillus plantarum WCFS1
Position: -93
Score: -2.25379
Sequence: AAGGTCAACAAAGGTCAAAGAGCC
Locus tag: lp_1269
Name: clpE
Funciton: ATP-dependent Clp protease, ATP-binding subunit ClpE
clpE -93 -2.3 AAGGTCAACAAAGGTCAAAGAGCC lp_1269
Lactobacillus reuteri JCM 1112
Position: -59
Score: 0.175316
Sequence: ATGGTCAAGAAAGGTCAAAACATT
Locus tag: LAR_1257
Name: clpE
Funciton: ATP-dependent Clp protease, ATP-binding subunit ClpE
clpE -59 0.2 ATGGTCAAGAAAGGTCAAAACATT LAR_1257
Lactobacillus rhamnosus GG
Position: -69
Score: 0.0981333
Sequence: TAGGTCAAGAAAGGTCAAACCTTT
Locus tag: LGG_01823
Name: clpE
Funciton: ATP-dependent Clp protease, ATP-binding subunit ClpE
clpE -69 0.1 TAGGTCAAGAAAGGTCAAACCTTT LGG_01823
Lactobacillus sakei subsp. sakei 23K
Position: -66
Score: -1.83873
Sequence: AAGGTCAAAGATAGTCAAACAAAC
Locus tag: LSA1465
Name: clpE
Funciton: ATP-dependent Clp protease, ATP-binding subunit ClpE
clpE -66 -1.8 AAGGTCAAAGATAGTCAAACAAAC LSA1465
Lactobacillus salivarius subsp. salivarius UCC118
Position: -57
Score: -1.61934
Sequence: AAGGTCAAAGTTGGTCAAAATAAC
Locus tag: LSL_0386
Name: clpE
Funciton: ATP-dependent Clp protease, ATP-binding subunit ClpE
clpE -57 -1.6 AAGGTCAAAGTTGGTCAAAATAAC LSL_0386
Oenococcus oeni PSU-1
Position: -27
Score: -1.34149
Sequence: AAGGTCAATAAAGGTCAAACATTG
Locus tag: OEOE_0640
Name: clpE
Funciton: ATP-dependent Clp protease, ATP-binding subunit ClpE
clpE -27 -1.3 AAGGTCAATAAAGGTCAAACATTG OEOE_0640
Pediococcus pentosaceus ATCC 25745
Position: -223
Score: -1.46087
Sequence: ATGGTCAATATTGGTCAAACATCA
Locus tag: PEPE_0607
Name: clpE
Funciton: ATP-dependent Clp protease, ATP-binding subunit ClpE
clpE -223 -1.5 ATGGTCAATATTGGTCAAACATCA PEPE_0607