Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing hsp gene

Properties
Regulog: CtsR - Lactobacillaceae
Regulator type: Transcription factor
Regulator family: CtsR
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Phylum: Firmicutes
Built upon 44 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Oenococcus oeni PSU-1
Position: -96
Score: 6.50893
Sequence: TTTTATTTGACCTTTCTTGACTTT
Locus tag: OEOE_0289
Name: hsp
Funciton: Small heat shock protein
hsp -96 6.5 TTTTATTTGACCTTTCTTGACTTT OEOE_0289