Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing clpB gene

Properties
Regulog: CtsR - Lactobacillaceae
Regulator type: Transcription factor
Regulator family: CtsR
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Phylum: Firmicutes
Built upon 44 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Lactobacillus brevis ATCC 367
Position: -139
Score: -1.6359
Sequence: TTGGTCAAAAAAGGTCAAATTATT
Locus tag: LVIS_0762
Name: clpB
Funciton: ATP-binding subunit of Clp protease and DnaK/DnaJ chaperones
clpB -139 -1.6 TTGGTCAAAAAAGGTCAAATTATT LVIS_0762
Lactobacillus plantarum WCFS1
Position: -118
Score: 6.47827
Sequence: AAATCCTTGACCTTGTTTGACCTT
Locus tag: lp_1903
Name: clpB
Funciton: ATP-binding subunit of Clp protease and DnaK/DnaJ chaperones
clpB -118 6.5 AAATCCTTGACCTTGTTTGACCTT lp_1903
Lactobacillus rhamnosus GG
Position: -73
Score: 6.17843
Sequence: AATAGTTTGACCTTAACTGACCAA
Locus tag: LGG_01367
Name: clpB
Funciton: ATP-binding subunit of Clp protease and DnaK/DnaJ chaperones
clpB -73 6.2 AATAGTTTGACCTTAACTGACCAA LGG_01367
Lactobacillus sakei subsp. sakei 23K
Position: -89
Score: 6.53688
Sequence: GAATGTTTGACCTATTTTGACTAT
Locus tag: LSA1040
Name: clpB
Funciton: ATP-binding subunit of Clp protease and DnaK/DnaJ chaperones
clpB -89 6.5 GAATGTTTGACCTATTTTGACTAT LSA1040
Lactobacillus salivarius subsp. salivarius UCC118
Position: -75
Score: -0.985392
Sequence: AAGGTCAAACTTAGTCAAAGTTTA
Locus tag: LSL_0863
Name: clpB
Funciton: ATP-binding subunit of Clp protease and DnaK/DnaJ chaperones
clpB -75 -1 AAGGTCAAACTTAGTCAAAGTTTA LSL_0863