Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing dnaJ gene

Regulog: CtsR - Lactobacillaceae
Regulator type: Transcription factor
Regulator family: CtsR
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Phylum: Firmicutes
Built upon 44 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Lactobacillus fermentum IFO 3956
Position: -89
Score: 6.36329
Locus tag: LAF_0749
Name: hrcA
Funciton: Heat shock response transcriptional regulator HrcA, HrcA family
Locus tag: LAF_0750
Name: grpE
Funciton: Heat shock protein GrpE
Locus tag: LAF_0751
Name: dnaK
Funciton: Chaperone protein DnaK
Locus tag: LAF_0752
Name: dnaJ
Funciton: Chaperone protein DnaJ
Lactobacillus plantarum WCFS1
Position: -91
Score: 5.89627
Locus tag: lp_2029
Name: hrcA
Funciton: Heat shock response transcriptional regulator HrcA, HrcA family
Locus tag: lp_2028
Name: grpE
Funciton: Heat shock protein GrpE
Locus tag: lp_2027
Name: dnaK
Funciton: Chaperone protein DnaK
Locus tag: lp_2026
Name: dnaJ
Funciton: Chaperone protein DnaJ
hrcA-grpE-dnaK-dnaJ -91 5.9 AATACTTTGTCTTTCCTTGACTTT lp_2029
Lactobacillus reuteri JCM 1112
Position: -101
Score: 6.54452
Locus tag: LAR_0677
Name: hrcA
Funciton: Heat shock response transcriptional regulator HrcA, HrcA family
Locus tag: LAR_0678
Name: grpE
Funciton: Heat shock protein GrpE
Locus tag: LAR_0679
Name: dnaK
Funciton: Chaperone protein DnaK
Locus tag: LAR_0680
Name: dnaJ
Funciton: Chaperone protein DnaJ
hrcA-grpE-dnaK-dnaJ -101 6.5 AATTGTTTGACGTTTCTTGACTTT LAR_0677
Lactobacillus sakei subsp. sakei 23K
Position: -87
Score: 5.25267
Locus tag: LSA1238
Name: hrcA
Funciton: Heat shock response transcriptional regulator HrcA, HrcA family
Locus tag: LSA1237
Name: grpE
Funciton: Heat shock protein GrpE
Locus tag: LSA1236
Name: dnaK
Funciton: Chaperone protein DnaK
Locus tag: LSA1235
Name: dnaJ
Funciton: Chaperone protein DnaJ
Oenococcus oeni PSU-1
Position: -71
Score: 6.53601
Locus tag: OEOE_1310
Name: grpE
Funciton: Heat shock protein GrpE
Locus tag: OEOE_1309
Name: dnaK
Funciton: Chaperone protein DnaK
Locus tag: OEOE_1308
Name: dnaJ
Funciton: Chaperone protein DnaJ
Pediococcus pentosaceus ATCC 25745
Position: -107
Score: 5.98678
Locus tag: PEPE_0894
Name: hrcA
Funciton: Heat shock response transcriptional regulator HrcA, HrcA family
Locus tag: PEPE_0895
Name: grpE
Funciton: Heat shock protein GrpE
Locus tag: PEPE_0896
Name: dnaK
Funciton: Chaperone protein DnaK
Locus tag: PEPE_0897
Name: dnaJ
Funciton: Chaperone protein DnaJ