Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing clpP gene

Properties
Regulog: CtsR - Lactobacillaceae
Regulator type: Transcription factor
Regulator family: CtsR
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Phylum: Firmicutes
Built upon 44 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Lactobacillus brevis ATCC 367
Position: -90
Score: 6.16577
Sequence: TTTTGTTTGACCTACTCTGACCTT
Locus tag: LVIS_0654
Name: clpP
Funciton: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
clpP -90 6.2 TTTTGTTTGACCTACTCTGACCTT LVIS_0654
Lactobacillus casei ATCC 334
Position: -85
Score: 7.04585
Sequence: AAATCTTTGACCTTATTTGACTTT
Locus tag: LSEI_0963
Name: clpP
Funciton: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
clpP -85 7 AAATCTTTGACCTTATTTGACTTT LSEI_0963
Lactobacillus fermentum IFO 3956
Position: -90
Score: 6.57105
Sequence: AATGATTTGACCTTTTTTGACCTA
Locus tag: LAF_0360
Name: clpP
Funciton: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
clpP -90 6.6 AATGATTTGACCTTTTTTGACCTA LAF_0360
Lactobacillus plantarum WCFS1
Position: -92
Score: 5.77559
Sequence: TTTCTTTTGACCTTCACTGACCTT
Locus tag: lp_0786
Name: clpP
Funciton: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
clpP -92 5.8 TTTCTTTTGACCTTCACTGACCTT lp_0786
Lactobacillus reuteri JCM 1112
Position: -93
Score: 6.68814
Sequence: AAACATTTGACCTTTTTTGACCAA
Locus tag: LAR_0379
Name: clpP
Funciton: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
clpP -93 6.7 AAACATTTGACCTTTTTTGACCAA LAR_0379
Lactobacillus rhamnosus GG
Position: -88
Score: 7.04585
Sequence: AAATCTTTGACCTTATTTGACTTT
Locus tag: LGG_00931
Name: clpP
Funciton: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
clpP -88 7 AAATCTTTGACCTTATTTGACTTT LGG_00931
Lactobacillus sakei subsp. sakei 23K
Position: -116
Score: 6.02412
Sequence: TACCATTTGACCATAGTTGACCTT
Locus tag: LSA0531
Name: clpP
Funciton: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
clpP -116 6 TACCATTTGACCATAGTTGACCTT LSA0531
Lactobacillus salivarius subsp. salivarius UCC118
Position: -101
Score: 6.25078
Sequence: TTAAATTTGACCATTATTGACCTT
Locus tag: LSL_1168
Name: clpP
Funciton: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
clpP -101 6.3 TTAAATTTGACCATTATTGACCTT LSL_1168
Oenococcus oeni PSU-1
Position: -63
Score: 6.73198
Sequence: AAAAGTTTGACCTTTCTTGACCAT
Locus tag: OEOE_0570
Name: clpP
Funciton: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
clpP -63 6.7 AAAAGTTTGACCTTTCTTGACCAT OEOE_0570
Pediococcus pentosaceus ATCC 25745
Position: -95
Score: 6.86454
Sequence: AAATATTTGACCTTTTTTGACCAA
Locus tag: PEPE_0455
Name: clpP
Funciton: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
clpP -95 6.9 AAATATTTGACCTTTTTTGACCAA PEPE_0455