Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing yffA gene

Properties
Regulog: CtsR - Streptococcaceae
Regulator type: Transcription factor
Regulator family: CtsR
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Phylum: Firmicutes
Built upon 68 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Lactococcus lactis subsp. cremoris SK11
Position: -119
Score: -0.38974
Sequence: ATGGTCAAATATGGTCAAGCTTTT
Locus tag: LACR_0577
Name: yffA
Funciton: Hypothetical protein
Locus tag: LACR_0578
Name: clpE
Funciton: ATP-dependent Clp protease, ATP-binding subunit ClpE
yffA-clpE -119 -0.4 ATGGTCAAATATGGTCAAGCTTTT LACR_0577
Lactococcus lactis subsp. lactis Il1403
Position: -117
Score: -0.914416
Sequence: ATGGTCAAATATGGTCAAACTTTT
Locus tag: L150017
Name: yffA
Funciton: Hypothetical protein
Locus tag: L0221
Name: clpE
Funciton: ATP-dependent Clp protease, ATP-binding subunit ClpE
yffA-clpE -117 -0.9 ATGGTCAAATATGGTCAAACTTTT L150017