Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing clpC gene

Properties
Regulog: CtsR - Streptococcaceae
Regulator type: Transcription factor
Regulator family: CtsR
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Phylum: Firmicutes
Built upon 68 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Lactococcus lactis subsp. cremoris SK11
Position: -56
Score: 0.423713
Sequence: ATAGTCAGTAATAGTCAAAGATTA
Locus tag: LACR_0665
Name: ctsR
Funciton: Stress and heat shock response transcriptional regulator CtsR, CtsR family
Locus tag: LACR_0666
Name: clpC
Funciton: ATP-dependent Clp protease ATP-binding subunit ClpC
ctsR-clpC -56 0.4 ATAGTCAGTAATAGTCAAAGATTA LACR_0665
Lactococcus lactis subsp. lactis Il1403
Position: -56
Score: 0.423713
Sequence: ATAGTCAGTAATAGTCAAAGATTA
Locus tag: L0223
Name: ctsR
Funciton: Stress and heat shock response transcriptional regulator CtsR, CtsR family
Locus tag: L0222
Name: clpC
Funciton: ATP-dependent Clp protease ATP-binding subunit ClpC
ctsR-clpC -56 0.4 ATAGTCAGTAATAGTCAAAGATTA L0223
Streptococcus agalactiae 2603V/R
Position: -36
Score: -0.674182
Sequence: ATAGTCAGTTATAGTCAAAGAGGA
Locus tag: SAG1829
Name: ctsR
Funciton: Stress and heat shock response transcriptional regulator CtsR, CtsR family
Locus tag: SAG1828
Name: clpC
Funciton: ATP-dependent Clp protease ATP-binding subunit ClpC
ctsR-clpC -36 -0.7 ATAGTCAGTTATAGTCAAAGAGGA SAG1829
Streptococcus equi subsp. zooepidemicus MGCS10565
Position: -69
Score: 0.792732
Sequence: TTAGTCAGTTTTAGTCAAAAATAA
Locus tag: Sez_0139
Name: ctsR
Funciton: Stress and heat shock response transcriptional regulator CtsR, CtsR family
Locus tag: Sez_0140
Name: clpC
Funciton: ATP-dependent Clp protease ATP-binding subunit ClpC
ctsR-clpC -69 0.8 TTAGTCAGTTTTAGTCAAAAATAA Sez_0139
Streptococcus gallolyticus UCN34
Position: -66
Score: -0.346024
Sequence: ATAGTCAGTTATAGTCAAAGATAG
Locus tag: GALLO_2164
Name: ctsR
Funciton: Stress and heat shock response transcriptional regulator CtsR, CtsR family
Locus tag: GALLO_2163
Name: clpC
Funciton: ATP-dependent Clp protease ATP-binding subunit ClpC
ctsR-clpC -66 -0.3 ATAGTCAGTTATAGTCAAAGATAG GALLO_2164
Streptococcus gordonii str. Challis substr. CH1
Position: -110
Score: 0.453539
Sequence: TTAGTCAAAGATAGTCAATGTCAA
Locus tag: SGO_1999
Name: ctsR
Funciton: Stress and heat shock response transcriptional regulator CtsR, CtsR family
Locus tag: SGO_1998
Name: clpC
Funciton: ATP-dependent Clp protease ATP-binding subunit ClpC
ctsR-clpC -110 0.5 TTAGTCAAAGATAGTCAATGTCAA SGO_1999
Streptococcus mitis B6
Position: -44
Score: 0.423713
Sequence: ATAGTCAAAGATAGTCAAGGTTTA
Locus tag: smi_2046
Name: ctsR
Funciton: Stress and heat shock response transcriptional regulator CtsR, CtsR family
Locus tag: smi_2045
Name: clpC
Funciton: ATP-dependent Clp protease ATP-binding subunit ClpC
ctsR-clpC -44 0.4 ATAGTCAAAGATAGTCAAGGTTTA smi_2046
Streptococcus pneumoniae TIGR4
Position: -44
Score: -0.429284
Sequence: ATAGTCAAACAAGGTCAAGGTTTA
Locus tag: SP_2195
Name: ctsR
Funciton: Stress and heat shock response transcriptional regulator CtsR, CtsR family
Locus tag: SP_2194
Name: clpC
Funciton: ATP-dependent Clp protease ATP-binding subunit ClpC
ctsR-clpC -44 -0.4 ATAGTCAAACAAGGTCAAGGTTTA SP_2195
Streptococcus pyogenes M1 GAS
Position: -78
Score: 0.112844
Sequence: ATAGTCAGTTTTAGTCAAAATGTA
Locus tag: SPy2074
Name: ctsR
Funciton: Stress and heat shock response transcriptional regulator CtsR, CtsR family
Locus tag: SPy2073
Name: clpC
Funciton: ATP-dependent Clp protease ATP-binding subunit ClpC
ctsR-clpC -78 0.1 ATAGTCAGTTTTAGTCAAAATGTA SPy2074
Streptococcus sanguinis SK36
Position: -77
Score: -0.221117
Sequence: TTAGTCAAAGATAGTCAATGTTAG
Locus tag: SSA_2200
Name: ctsR
Funciton: Stress and heat shock response transcriptional regulator CtsR, CtsR family
Locus tag: SSA_2199
Name: clpC
Funciton: ATP-dependent Clp protease ATP-binding subunit ClpC
ctsR-clpC -77 -0.2 TTAGTCAAAGATAGTCAATGTTAG SSA_2200
Streptococcus suis 05ZYH33
Position: -34
Score: -0.875808
Sequence: ATGGTCAAAGATAGTCAAAGAAAG
Locus tag: SSU05_1976
Name: ctsR
Funciton: Stress and heat shock response transcriptional regulator CtsR, CtsR family
Locus tag: SSU05_1975
Name: clpC
Funciton: ATP-dependent Clp protease ATP-binding subunit ClpC
ctsR-clpC -34 -0.9 ATGGTCAAAGATAGTCAAAGAAAG SSU05_1976
Streptococcus thermophilus CNRZ1066
Position: -38
Score: -0.674182
Sequence: ATAGTCAGTTATAGTCAAATTAGA
Locus tag: str0076
Name: ctsR
Funciton: Stress and heat shock response transcriptional regulator CtsR, CtsR family
Locus tag: str0077
Name: clpC
Funciton: ATP-dependent Clp protease ATP-binding subunit ClpC
ctsR-clpC -38 -0.7 ATAGTCAGTTATAGTCAAATTAGA str0076