Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing clpP gene

Properties
Regulog: CtsR - Streptococcaceae
Regulator type: Transcription factor
Regulator family: CtsR
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Phylum: Firmicutes
Built upon 68 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Lactococcus lactis subsp. cremoris SK11
Position: -110
Score: 6.80258
Sequence: TTTTCTTTGACCTTTTTTGACCAA
Locus tag: LACR_0700
Name: clpP
Funciton: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
clpP -110 6.8 TTTTCTTTGACCTTTTTTGACCAA LACR_0700
Lactococcus lactis subsp. lactis Il1403
Position: -110
Score: 6.83684
Sequence: TATTCTTTGACCTTTTTTGACCAA
Locus tag: L72391
Name: clpP
Funciton: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
clpP -110 6.8 TATTCTTTGACCTTTTTTGACCAA L72391
Streptococcus agalactiae 2603V/R
Position: -67
Score: 6.6062
Sequence: TATTATTTGACCTTTGTTGACCAA
Locus tag: SAG1585
Name: clpP
Funciton: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
clpP -67 6.6 TATTATTTGACCTTTGTTGACCAA SAG1585
Streptococcus dysgalactiae subsp. equisimilis GGS_124
Position: -125
Score: 6.45657
Sequence: TATCATTTGACCTTTCTTGACCAA
Locus tag: SDEG_0439
Name: clpP
Funciton: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
clpP -125 6.5 TATCATTTGACCTTTCTTGACCAA SDEG_0439
Streptococcus equi subsp. zooepidemicus MGCS10565
Position: -93
Score: 6.84544
Sequence: TATCATTTGACCTTTTTTGACCAA
Locus tag: Sez_1614
Name: clpP
Funciton: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
clpP -93 6.8 TATCATTTGACCTTTTTTGACCAA Sez_1614
Streptococcus gallolyticus UCN34
Position: -127
Score: 6.96082
Sequence: TTTTATTTGACCTTTTTTGACCAA
Locus tag: GALLO_1763
Name: clpP
Funciton: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
clpP -127 7 TTTTATTTGACCTTTTTTGACCAA GALLO_1763
Streptococcus gordonii str. Challis substr. CH1
Position: -103
Score: 6.63859
Sequence: AAAAATTTGACCTTTATTGACCAA
Locus tag: SGO_1632
Name: clpP
Funciton: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
clpP -103 6.6 AAAAATTTGACCTTTATTGACCAA SGO_1632
Streptococcus mitis B6
Position: -89
Score: 6.78449
Sequence: AAAAATTTGACCTTTTTTGACCAA
Locus tag: smi_1417
Name: clpP
Funciton: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
clpP -89 6.8 AAAAATTTGACCTTTTTTGACCAA smi_1417
Streptococcus mutans UA159
Position: -68
Score: 6.83975
Sequence: AAATATTTGACCTTTTTTGACCAA
Locus tag: SMU.1672
Name: clpP
Funciton: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
clpP -68 6.8 AAATATTTGACCTTTTTTGACCAA SMU.1672
Streptococcus pneumoniae TIGR4
Position: -89
Score: 6.78449
Sequence: AAAAATTTGACCTTTTTTGACCAA
Locus tag: SP_0746
Name: clpP
Funciton: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
clpP -89 6.8 AAAAATTTGACCTTTTTTGACCAA SP_0746
Streptococcus pyogenes M1 GAS
Position: -125
Score: 6.56646
Sequence: TATGATTTGACCTTTATTGACCAA
Locus tag: SPy0395
Name: clpP
Funciton: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
clpP -125 6.6 TATGATTTGACCTTTATTGACCAA SPy0395
Streptococcus sanguinis SK36
Position: -103
Score: 6.61783
Sequence: TTCTATTTGACCTTTTTTGACCAA
Locus tag: SSA_1731
Name: clpP
Funciton: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
clpP -103 6.6 TTCTATTTGACCTTTTTTGACCAA SSA_1731
Streptococcus suis 05ZYH33
Position: -67
Score: 6.10436
Sequence: TTTTTATTGACCAATTTTGACTAT
Locus tag: SSU05_1551
Name: clpP
Funciton: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
Locus tag: SSU05_1550
Name: clpP
Funciton: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
clpP-clpP -67 6.1 TTTTTATTGACCAATTTTGACTAT SSU05_1551
Streptococcus thermophilus CNRZ1066
Position: -67
Score: 6.242
Sequence: TTTTATTTGACCTAATTTGACTAA
Locus tag: str0356
Name: clpP
Funciton: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
clpP -67 6.2 TTTTATTTGACCTAATTTGACTAA str0356
Streptococcus uberis 0140J
Position: -98
Score: 6.73002
Sequence: TATTATTTGACCTTATTTGACCAA
Locus tag: SUB0429
Name: clpP
Funciton: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
clpP -98 6.7 TATTATTTGACCTTATTTGACCAA SUB0429