Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing groL gene

Regulog: CtsR - Streptococcaceae
Regulator type: Transcription factor
Regulator family: CtsR
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Phylum: Firmicutes
Built upon 68 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Lactococcus lactis subsp. cremoris SK11
Position: -95
Score: 5.92574
Locus tag: LACR_0439
Name: groS
Funciton: Heat shock protein 60 family co-chaperone GroES
Locus tag: LACR_0440
Name: groL
Funciton: Heat shock protein 60 family chaperone GroEL
Lactococcus lactis subsp. lactis Il1403
Position: -96
Score: 5.92574
Locus tag: L198515
Name: groS
Funciton: Heat shock protein 60 family co-chaperone GroES
Locus tag: L198893
Name: groL
Funciton: Heat shock protein 60 family chaperone GroEL
Streptococcus agalactiae 2603V/R
Position: -109
Score: 6.34428
Locus tag: SAG2075
Name: groS
Funciton: Heat shock protein 60 family co-chaperone GroES
Locus tag: SAG2074
Name: groL
Funciton: Heat shock protein 60 family chaperone GroEL
Streptococcus dysgalactiae subsp. equisimilis GGS_124
Position: -106
Score: 6.86088
Locus tag: SDEG_2041
Name: groS
Funciton: Heat shock protein 60 family co-chaperone GroES
Locus tag: SDEG_2040
Name: groL
Funciton: Heat shock protein 60 family chaperone GroEL
Streptococcus equi subsp. zooepidemicus MGCS10565
Position: -110
Score: 6.86088
Locus tag: Sez_0145
Name: groS
Funciton: Heat shock protein 60 family co-chaperone GroES
Locus tag: Sez_0146
Name: groL
Funciton: Heat shock protein 60 family chaperone GroEL
Streptococcus gallolyticus UCN34
Position: -134
Score: 6.76219
Locus tag: GALLO_0124
Name: groS
Funciton: Heat shock protein 60 family co-chaperone GroES
Locus tag: GALLO_0125
Name: groL
Funciton: Heat shock protein 60 family chaperone GroEL
Streptococcus gordonii str. Challis substr. CH1
Position: -96
Score: 6.86088
Locus tag: SGO_1886
Name: groS
Funciton: Heat shock protein 60 family co-chaperone GroES
Locus tag: SGO_1885
Name: groL
Funciton: Heat shock protein 60 family chaperone GroEL
Streptococcus mitis B6
Position: -102
Score: 6.76219
Locus tag: smi_0481
Name: groS
Funciton: Heat shock protein 60 family co-chaperone GroES
Locus tag: smi_0482
Name: groL
Funciton: Heat shock protein 60 family chaperone GroEL
groS-groL -102 6.8 TTTTTCTTGACTATTTCTGACCAA smi_0481
Streptococcus mutans UA159
Position: -91
Score: 6.86088
Locus tag: SMU.1955
Name: groS
Funciton: Heat shock protein 60 family co-chaperone GroES
Locus tag: SMU.1954
Name: groL
Funciton: Heat shock protein 60 family chaperone GroEL
Streptococcus pneumoniae TIGR4
Position: -102
Score: 6.23751
Locus tag: SP_1907
Name: groS
Funciton: Heat shock protein 60 family co-chaperone GroES
Locus tag: SP_1906
Name: groL
Funciton: Heat shock protein 60 family chaperone GroEL
Streptococcus pyogenes M1 GAS
Position: -107
Score: 6.86088
Locus tag: SPy2072
Name: groS
Funciton: Heat shock protein 60 family co-chaperone GroES
Locus tag: SPy2070
Name: groL
Funciton: Heat shock protein 60 family chaperone GroEL
Streptococcus sanguinis SK36
Position: -97
Score: 6.76219
Locus tag: SSA_0225
Name: groS
Funciton: Heat shock protein 60 family co-chaperone GroES
Locus tag: SSA_0226
Name: groL
Funciton: Heat shock protein 60 family chaperone GroEL
Streptococcus suis 05ZYH33
Position: -66
Score: 6.48664
Locus tag: SSU05_0147
Name: groS
Funciton: Heat shock protein 60 family co-chaperone GroES
Locus tag: SSU05_0148
Name: groL
Funciton: Heat shock protein 60 family chaperone GroEL
Locus tag: SSU05_0149
Name: groL
Funciton: Heat shock protein 60 family chaperone GroEL
Streptococcus thermophilus CNRZ1066
Position: -124
Score: 6.6754
Locus tag: str0203
Name: groS
Funciton: Heat shock protein 60 family co-chaperone GroES
Locus tag: str0204
Name: groL
Funciton: Heat shock protein 60 family chaperone GroEL
Streptococcus uberis 0140J
Position: -108
Score: 6.59261
Locus tag: SUB1742
Name: groS
Funciton: Heat shock protein 60 family co-chaperone GroES
Locus tag: SUB1741
Name: groL
Funciton: Heat shock protein 60 family chaperone GroEL