Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing clpE gene

Properties
Regulog: CtsR - Streptococcaceae
Regulator type: Transcription factor
Regulator family: CtsR
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Phylum: Firmicutes
Built upon 68 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Lactococcus lactis subsp. cremoris SK11
Position: -119
Score: -0.38974
Sequence: ATGGTCAAATATGGTCAAGCTTTT
Locus tag: LACR_0577
Name: yffA
Funciton: Hypothetical protein
Locus tag: LACR_0578
Name: clpE
Funciton: ATP-dependent Clp protease, ATP-binding subunit ClpE
yffA-clpE -119 -0.4 ATGGTCAAATATGGTCAAGCTTTT LACR_0577
Lactococcus lactis subsp. lactis Il1403
Position: -117
Score: -0.914416
Sequence: ATGGTCAAATATGGTCAAACTTTT
Locus tag: L150017
Name: yffA
Funciton: Hypothetical protein
Locus tag: L0221
Name: clpE
Funciton: ATP-dependent Clp protease, ATP-binding subunit ClpE
yffA-clpE -117 -0.9 ATGGTCAAATATGGTCAAACTTTT L150017
Streptococcus agalactiae 2603V/R
Position: -65
Score: 6.25458
Sequence: TAAAGTTTGACTATATTTGACTAT
Locus tag: SAG0488
Name: clpE
Funciton: ATP-dependent Clp protease, ATP-binding subunit ClpE
clpE -65 6.3 TAAAGTTTGACTATATTTGACTAT SAG0488
Streptococcus dysgalactiae subsp. equisimilis GGS_124
Position: -62
Score: 6.71234
Sequence: TAAAGTTTGACCATTTTTGACTAA
Locus tag: SDEG_1496
Name: clpE
Funciton: ATP-dependent Clp protease, ATP-binding subunit ClpE
clpE -62 6.7 TAAAGTTTGACCATTTTTGACTAA SDEG_1496
Streptococcus equi subsp. zooepidemicus MGCS10565
Position: -63
Score: 6.71234
Sequence: TAAAGTTTGACCATTTTTGACTAA
Locus tag: Sez_0605
Name: clpE
Funciton: ATP-dependent Clp protease, ATP-binding subunit ClpE
clpE -63 6.7 TAAAGTTTGACCATTTTTGACTAA Sez_0605
Streptococcus gallolyticus UCN34
Position: -65
Score: 5.69378
Sequence: TGAAGTTTGACTATCTTTGACCTT
Locus tag: GALLO_0612
Name: clpE
Funciton: ATP-dependent Clp protease, ATP-binding subunit ClpE
clpE -65 5.7 TGAAGTTTGACTATCTTTGACCTT GALLO_0612
Streptococcus gordonii str. Challis substr. CH1
Position: -65
Score: 6.8586
Sequence: TAAAGTTTGACTATTTTTGACCAA
Locus tag: SGO_0688
Name: clpE
Funciton: ATP-dependent Clp protease, ATP-binding subunit ClpE
clpE -65 6.9 TAAAGTTTGACTATTTTTGACCAA SGO_0688
Streptococcus mitis B6
Position: -62
Score: 6.27038
Sequence: TAGAATTTGACTATTTTTGACCTT
Locus tag: smi_0865
Name: clpE
Funciton: ATP-dependent Clp protease, ATP-binding subunit ClpE
clpE -62 6.3 TAGAATTTGACTATTTTTGACCTT smi_0865
Streptococcus mutans UA159
Position: -74
Score: 6.59844
Sequence: TAAAGTTTGACCATTATTGACCAT
Locus tag: SMU.562
Name: clpE
Funciton: ATP-dependent Clp protease, ATP-binding subunit ClpE
clpE -74 6.6 TAAAGTTTGACCATTATTGACCAT SMU.562
Streptococcus pneumoniae TIGR4
Position: -62
Score: 6.27038
Sequence: TAGAATTTGACTATTTTTGACCTT
Locus tag: SP_0820
Name: clpE
Funciton: ATP-dependent Clp protease, ATP-binding subunit ClpE
clpE -62 6.3 TAGAATTTGACTATTTTTGACCTT SP_0820
Streptococcus pyogenes M1 GAS
Position: -62
Score: 6.71234
Sequence: TAAAGTTTGACCATTTTTGACTAA
Locus tag: SPy1509
Name: clpE
Funciton: ATP-dependent Clp protease, ATP-binding subunit ClpE
clpE -62 6.7 TAAAGTTTGACCATTTTTGACTAA SPy1509
Streptococcus sanguinis SK36
Position: -73
Score: 6.20615
Sequence: AAAACTTTGACTATTTTTGACCTT
Locus tag: SSA_0669
Name: clpE
Funciton: ATP-dependent Clp protease, ATP-binding subunit ClpE
clpE -73 6.2 AAAACTTTGACTATTTTTGACCTT SSA_0669
Streptococcus thermophilus CNRZ1066
Position: -75
Score: 6.52277
Sequence: ATAGATTTGACCTTTTTTGACCAA
Locus tag: str0602
Name: clpE
Funciton: ATP-dependent Clp protease, ATP-binding subunit ClpE
clpE -75 6.5 ATAGATTTGACCTTTTTTGACCAA str0602
Streptococcus uberis 0140J
Position: -61
Score: 6.71234
Sequence: TAAAGTTTGACCATTTTTGACTAA
Locus tag: SUB1281
Name: clpE
Funciton: ATP-dependent Clp protease, ATP-binding subunit ClpE
clpE -61 6.7 TAAAGTTTGACCATTTTTGACTAA SUB1281