Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing clpL gene

Properties
Regulog: CtsR - Streptococcaceae
Regulator type: Transcription factor
Regulator family: CtsR
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Phylum: Firmicutes
Built upon 68 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Streptococcus agalactiae 2603V/R
Position: -144
Score: 6.29907
Sequence: TATTTATTGACCTTTACTGACTAA
Locus tag: SAG1303
Name: clpL
Funciton: ATP-dependent Clp protease, ATP-binding subunit
clpL -144 6.3 TATTTATTGACCTTTACTGACTAA SAG1303
Streptococcus dysgalactiae subsp. equisimilis GGS_124
Position: -180
Score: 6.42288
Sequence: TTTTGTTTGACCTTAACTGACCAA
Locus tag: SDEG_0851
Name: clpL
Funciton: ATP-dependent Clp protease, ATP-binding subunit
clpL -180 6.4 TTTTGTTTGACCTTAACTGACCAA SDEG_0851
Streptococcus equi subsp. zooepidemicus MGCS10565
Position: -181
Score: 6.29035
Sequence: TTTTGTTTGACCTTTACTGACCTT
Locus tag: Sez_1072
Name: clpL
Funciton: ATP-dependent Clp protease, ATP-binding subunit
clpL -181 6.3 TTTTGTTTGACCTTTACTGACCTT Sez_1072
Streptococcus gallolyticus UCN34
Position: -190
Score: 6.55594
Sequence: AAATATTTGACTTTTACTGACCAA
Locus tag: GALLO_1249
Name: clpL
Funciton: ATP-dependent Clp protease, ATP-binding subunit
clpL -190 6.6 AAATATTTGACTTTTACTGACCAA GALLO_1249
Streptococcus mitis B6
Position: -276
Score: 6.31165
Sequence: AAATCCTTGACCTTTTCTGACTAA
Locus tag: smi_1765
Name: clpL
Funciton: ATP-dependent Clp protease, ATP-binding subunit
clpL -276 6.3 AAATCCTTGACCTTTTCTGACTAA smi_1765
Streptococcus pneumoniae TIGR4
Position: -275
Score: 6.514
Sequence: AAACTCTTGACCTTTTCTGACCAA
Locus tag: SP_0338
Name: clpL
Funciton: ATP-dependent Clp protease, ATP-binding subunit
clpL -275 6.5 AAACTCTTGACCTTTTCTGACCAA SP_0338
Streptococcus pyogenes M1 GAS
Position: -172
Score: 6.29035
Sequence: TTTTGTTTGACCTTTACTGACCTT
Locus tag: SPy0888
Name: clpL
Funciton: ATP-dependent Clp protease, ATP-binding subunit
clpL -172 6.3 TTTTGTTTGACCTTTACTGACCTT SPy0888
Streptococcus suis 05ZYH33
Position: -254
Score: 6.14037
Sequence: AAACTATTGACTTTTACTGACCAA
Locus tag: SSU05_0389
Name: clpL
Funciton: ATP-dependent Clp protease, ATP-binding subunit
Locus tag: SSU05_0390
Name: clpL
Funciton: ATP-dependent Clp protease, ATP-binding subunit
Locus tag: SSU05_0391
Name: clpL
Funciton: ATP-dependent Clp protease, ATP-binding subunit
clpL-clpL-clpL -254 6.1 AAACTATTGACTTTTACTGACCAA SSU05_0389
Streptococcus thermophilus CNRZ1066
Position: -84
Score: -0.0822352
Sequence: TTGGTCAGTAAAAGTCAATTTTTA
Locus tag: str1614
Name: clpL
Funciton: ATP-dependent Clp protease, ATP-binding subunit
clpL -84 -0.1 TTGGTCAGTAAAAGTCAATTTTTA str1614
Streptococcus uberis 0140J
Position: -152
Score: 6.88339
Sequence: TTTTTCTTGACCTTTTTTGACCAA
Locus tag: SUB0776
Name: clpL
Funciton: ATP-dependent Clp protease, ATP-binding subunit
clpL -152 6.9 TTTTTCTTGACCTTTTTTGACCAA SUB0776