Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing clpB gene

Properties
Regulog: CtsR - Streptococcaceae
Regulator type: Transcription factor
Regulator family: CtsR
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Phylum: Firmicutes
Built upon 68 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Lactococcus lactis subsp. cremoris SK11
Position: -98
Score: 6.25715
Sequence: AAAAGCTTGACCATTACTGACTAA
Locus tag: LACR_1612
Name: clpB
Funciton: ATP-binding subunit of Clp protease and DnaK/DnaJ chaperones
clpB -98 6.3 AAAAGCTTGACCATTACTGACTAA LACR_1612
Lactococcus lactis subsp. lactis Il1403
Position: -98
Score: 6.52833
Sequence: AAAAGTTTGACCATTACTGACCAA
Locus tag: L166407
Name: clpB
Funciton: ATP-binding subunit of Clp protease and DnaK/DnaJ chaperones
clpB -98 6.5 AAAAGTTTGACCATTACTGACCAA L166407