Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing grtP gene

Properties
Regulog: SdaR - Lactobacillaceae
Regulator type: Transcription factor
Regulator family: SdaR
Regulation mode: repressor
Biological process: Glycerate utilization
Effector: D-glycerate
Phylum: Firmicutes
Built upon 5 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Lactobacillus brevis ATCC 367
Position: -123
Score: 4.81468
Sequence: CATAGTTACATTGATCAATT
Locus tag: LVIS_0412
Name: grtP
Funciton: D-glycerate transporter, GntP family
Locus tag: LVIS_0413
Name: garK
Funciton: Glycerate kinase (EC 2.7.1.31)
grtP-garK -123 4.8 CATAGTTACATTGATCAATT LVIS_0412
Lactobacillus reuteri JCM 1112
Position: -172
Score: 4.99688
Sequence: TTTTGATAATAGGAACTATG
Locus tag: LAR_0600
Name: grtP
Funciton: D-glycerate transporter, GntP family
Locus tag: LAR_0601
Name: garK
Funciton: Glycerate kinase (EC 2.7.1.31)
grtP-garK -172 5 TTTTGATAATAGGAACTATG LAR_0600
Lactobacillus sakei subsp. sakei 23K
Position: -38
Score: 4.86187
Sequence: GATTGTGTTATATAACAAAA
Locus tag: LSA0711
Name: grtP
Funciton: D-glycerate transporter, GntP family
Locus tag: LSA0712
Name: garK
Funciton: Glycerate kinase (EC 2.7.1.31)
grtP-garK -38 4.9 GATTGTGTTATATAACAAAA LSA0711