Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing sdaR gene

Properties
Regulog: SdaR - Lactobacillaceae
Regulator type: Transcription factor
Regulator family: SdaR
Regulation mode: repressor
Biological process: Glycerate utilization
Effector: D-glycerate
Phylum: Firmicutes
Built upon 5 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Lactobacillus brevis ATCC 367
Position: -190
Score: 4.81468
Sequence: AATTGATCAATGTAACTATG
Locus tag: LVIS_0411
Name: sdaR
Funciton: Glycerate utilization transcriptional regulator SdaR, SdaR family
sdaR -190 4.8 AATTGATCAATGTAACTATG LVIS_0411
Lactobacillus reuteri JCM 1112
Position: -338
Score: 4.99688
Sequence: CATAGTTCCTATTATCAAAA
Locus tag: LAR_0599
Name: sdaR
Funciton: Glycerate utilization transcriptional regulator SdaR, SdaR family
sdaR -338 5 CATAGTTCCTATTATCAAAA LAR_0599