Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing rbsB gene

Properties
Regulog: RbsR2 - Streptococcaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Ribose utilization
Effector: Ribose
Phylum: Firmicutes
Built upon 9 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Lactococcus lactis subsp. lactis Il1403
Position: -66
Score: 6.20633
Sequence: TAATGAAAACGGATACAATT
Locus tag: L0145
Name: rbsR2
Funciton: Transcriptional repressor of ribose utilization RbsR2, LacI family
Locus tag: L86157
Name: rbsK
Funciton: Ribokinase (EC 2.7.1.15)
Locus tag: L85737
Name: rbsD
Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
Locus tag: L84240
Name: rbsA
Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
Locus tag: L83296
Name: rbsC
Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
Locus tag: L82310
Name: rbsB
Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
rbsR2-rbsK-rbsD-rbsA-rbsC-rbsB -66 6.2 TAATGAAAACGGATACAATT L0145
Streptococcus agalactiae 2603V/R
Position: -38
Score: 5.37924
Sequence: TTGTGAAACCGTTTCCACAA
Locus tag: SAG0119
Name: rbsR2
Funciton: Transcriptional repressor of ribose utilization RbsR2, LacI family
Locus tag: SAG0118
Name: rbsK
Funciton: Ribokinase (EC 2.7.1.15)
Locus tag: SAG0117
Name: rbsD
Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
Locus tag: SAG0116
Name: rbsA
Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
Locus tag: SAG0115
Name: rbsC
Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
Locus tag: SAG0114
Name: rbsB
Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
rbsR2-rbsK-rbsD-rbsA-rbsC-rbsB -38 5.4 TTGTGAAACCGTTTCCACAA SAG0119
Streptococcus dysgalactiae subsp. equisimilis GGS_124
Position: -67
Score: 6.04811
Sequence: AAAAGAAAACGGTTACAACA
Position: -43
Score: 5.40656
Sequence: ACGTGAGAACGGTTCCACAA
Locus tag: SDEG_1537
Name: rbsR2
Funciton: Transcriptional repressor of ribose utilization RbsR2, LacI family
Locus tag: SDEG_1536
Name: rbsK
Funciton: Ribokinase (EC 2.7.1.15)
Locus tag: SDEG_1535
Name: rbsD
Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
Locus tag: SDEG_1534
Name: rbsA
Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
Locus tag: SDEG_1533
Name: rbsB
Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
rbsR2-rbsK-rbsD-rbsA-rbsB -67 6 AAAAGAAAACGGTTACAACA SDEG_1537
-43 5.4 ACGTGAGAACGGTTCCACAA
Streptococcus equi subsp. zooepidemicus MGCS10565
Position: -62
Score: 6.27021
Sequence: TTTAGAAAACGGTTACAATA
Position: -39
Score: 5.5586
Sequence: ACATGAGAACGGTTCCACAA
Locus tag: Sez_0468
Name: rbsR2
Funciton: Transcriptional repressor of ribose utilization RbsR2, LacI family
Locus tag: Sez_0469
Name: rbsK
Funciton: Ribokinase (EC 2.7.1.15)
Locus tag: Sez_0470
Name: rbsD
Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
Locus tag: Sez_0471
Name: rbsA
Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
Locus tag: Sez_0472
Name: rbsC
Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
Locus tag: Sez_0473
Name: rbsB
Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
rbsR2-rbsK-rbsD-rbsA-rbsC-rbsB -62 6.3 TTTAGAAAACGGTTACAATA Sez_0468
-39 5.6 ACATGAGAACGGTTCCACAA
Streptococcus uberis 0140J
Position: -47
Score: 6.67471
Sequence: TAAAGAAAACGGTTACAATA
Locus tag: SUB1312
Name: rbsR2
Funciton: Transcriptional repressor of ribose utilization RbsR2, LacI family
Locus tag: SUB1311
Name: rbsK
Funciton: Ribokinase (EC 2.7.1.15)
Locus tag: SUB1310
Name: rbsD
Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
Locus tag: SUB1309
Name: rbsA
Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
Locus tag: SUB1308
Name: rbsC
Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
Locus tag: SUB1307
Name: rbsB
Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
rbsR2-rbsK-rbsD-rbsA-rbsC-rbsB -47 6.7 TAAAGAAAACGGTTACAATA SUB1312