Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing hyl gene

Properties
Regulog: RegR - Streptococcaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Hyaluronate utilization
Effector: Hyaluronate oligosaccharide phosphate
Phylum: Firmicutes
Built upon 27 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Streptococcus agalactiae 2603V/R
Position: -42
Score: 5.03814
Sequence: AGGAAAAACCGGTTTACAAT
Locus tag: SAG1197
Name: hyl
Funciton: Hyaluronate lyase precursor (EC 4.2.2.1)
hyl -42 5 AGGAAAAACCGGTTTACAAT SAG1197
Streptococcus dysgalactiae subsp. equisimilis GGS_124
Position: -74
Score: 5.11186
Sequence: TGACAAAACTAGTTTACTTT
Position: -45
Score: 6.0807
Sequence: TTGGTAAACAGGTTTACTTA
Locus tag: SDEG_0650
Name: kduD
Funciton: 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase (EC 1.1.1.127)
Locus tag: SDEG_0651
Name: kduI
Funciton: 5-keto-4-deoxyuronate isomerase (EC 5.3.1.17)
Locus tag: SDEG_0652
Name: kdgK
Funciton: 2-dehydro-3-deoxygluconate kinase (EC 2.7.1.45)
Locus tag: SDEG_0653
Name: kdgA
Funciton: 2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14)
Locus tag: SDEG_0654
Name: hyl
Funciton: Hyaluronate lyase precursor (EC 4.2.2.1)
kduD-kduI-kdgK-kdgA-hyl -74 5.1 TGACAAAACTAGTTTACTTT SDEG_0650
-45 6.1 TTGGTAAACAGGTTTACTTA
Streptococcus equi subsp. zooepidemicus MGCS10565
Position: -293
Score: 5.3494
Sequence: TTAGTTTACCGGTTTACTTA
Position: -45
Score: 6.0807
Sequence: TTGGTAAACAGGTTTACTTA
Locus tag: Sez_1303
Name: kduD
Funciton: 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase (EC 1.1.1.127)
Locus tag: Sez_1302
Name: kduI
Funciton: 5-keto-4-deoxyuronate isomerase (EC 5.3.1.17)
Locus tag: Sez_1301
Name: kdgK
Funciton: 2-dehydro-3-deoxygluconate kinase (EC 2.7.1.45)
Locus tag: Sez_1300
Name: kdgA
Funciton: 2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14)
Locus tag: Sez_1299
Name: hyl
Funciton: Hyaluronate lyase precursor (EC 4.2.2.1)
kduD-kduI-kdgK-kdgA-hyl -293 5.3 TTAGTTTACCGGTTTACTTA Sez_1303
-45 6.1 TTGGTAAACAGGTTTACTTA
Streptococcus pneumoniae TIGR4
Position: -89
Score: 6.23897
Sequence: TAATTAAACCGGTTTACTTA
Locus tag: SP_0314
Name: hyl
Funciton: Hyaluronate lyase precursor (EC 4.2.2.1)
hyl -89 6.2 TAATTAAACCGGTTTACTTA SP_0314
Streptococcus pyogenes M1 GAS
Position: -54
Score: 5.45941
Sequence: TTAGTAAATCAATTTACTTT
Locus tag: SPy1032
Name: hyl
Funciton: Hyaluronate lyase precursor (EC 4.2.2.1)
hyl -54 5.5 TTAGTAAATCAATTTACTTT SPy1032
Streptococcus suis 05ZYH33
Position: -33
Score: 4.91289
Sequence: TAGGTAAACCGGTAAAGTTA
Locus tag: SSU05_1221
Name: hylD
Funciton: PTS system, hyaluronate-oligosaccharide-specific IIA component (EC 2.7.1.69)
Locus tag: SSU05_1220
Name: ugl
Funciton: Unsaturated glucuronyl hydrolase (EC 3.2.1.-)
Locus tag: SSU05_1219
Name: hylE
Funciton: PTS system, hyaluronate-oligosaccharide-specific IIB component (EC 2.7.1.69)
Locus tag: SSU05_1218
Name: hylF
Funciton: PTS system, hyaluronate-oligosaccharide-specific IIC component (EC 2.7.1.69)
Locus tag: SSU05_1217
Name: hylG
Funciton: PTS system, hyaluronate-oligosaccharide-specific IID component (EC 2.7.1.69)
Locus tag: SSU05_1216
Name: yajC
Funciton: Preprotein translocase subunit YajC (TC 3.A.5.1.1)
Locus tag: SSU05_1215
Name: hyl
Funciton: Hyaluronate lyase precursor (EC 4.2.2.1)
Locus tag: SSU05_1214
Name: hyl
Funciton: Hyaluronate lyase precursor (EC 4.2.2.1)
Locus tag: SSU05_1213
Name: hyl
Funciton: Hyaluronate lyase precursor (EC 4.2.2.1)
Locus tag: SSU05_1212
Name: hyl
Funciton: Hyaluronate lyase precursor (EC 4.2.2.1)
hylD-ugl-hylE-hylF-hylG-yajC-hyl-hyl-hyl-hyl -33 4.9 TAGGTAAACCGGTAAAGTTA SSU05_1221