Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing kduD gene

Regulog: RegR - Streptococcaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Hyaluronate utilization
Effector: Hyaluronate oligosaccharide phosphate
Phylum: Firmicutes
Built upon 27 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Streptococcus agalactiae 2603V/R
Position: -265
Score: 5.12804
Position: -75
Score: 5.85934
Position: -46
Score: 5.09009
Locus tag: SAG1904
Name: kduD
Funciton: 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase (EC
Locus tag: SAG1905
Name: kduI
Funciton: 5-keto-4-deoxyuronate isomerase (EC
Locus tag: SAG1906
Name: kdgK
Funciton: 2-dehydro-3-deoxygluconate kinase (EC
Locus tag: SAG1907
Name: kdgA
Funciton: 2-dehydro-3-deoxyphosphogluconate aldolase (EC
kduD-kduI-kdgK-kdgA -265 5.1 TGAGTTTACCGGTTTACTTT SAG1904
Streptococcus dysgalactiae subsp. equisimilis GGS_124
Position: -74
Score: 5.11186
Position: -45
Score: 6.0807
Locus tag: SDEG_0650
Name: kduD
Funciton: 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase (EC
Locus tag: SDEG_0651
Name: kduI
Funciton: 5-keto-4-deoxyuronate isomerase (EC
Locus tag: SDEG_0652
Name: kdgK
Funciton: 2-dehydro-3-deoxygluconate kinase (EC
Locus tag: SDEG_0653
Name: kdgA
Funciton: 2-dehydro-3-deoxyphosphogluconate aldolase (EC
Locus tag: SDEG_0654
Name: hyl
Funciton: Hyaluronate lyase precursor (EC
kduD-kduI-kdgK-kdgA-hyl -74 5.1 TGACAAAACTAGTTTACTTT SDEG_0650
Streptococcus equi subsp. zooepidemicus MGCS10565
Position: -293
Score: 5.3494
Position: -45
Score: 6.0807
Locus tag: Sez_1303
Name: kduD
Funciton: 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase (EC
Locus tag: Sez_1302
Name: kduI
Funciton: 5-keto-4-deoxyuronate isomerase (EC
Locus tag: Sez_1301
Name: kdgK
Funciton: 2-dehydro-3-deoxygluconate kinase (EC
Locus tag: Sez_1300
Name: kdgA
Funciton: 2-dehydro-3-deoxyphosphogluconate aldolase (EC
Locus tag: Sez_1299
Name: hyl
Funciton: Hyaluronate lyase precursor (EC
kduD-kduI-kdgK-kdgA-hyl -293 5.3 TTAGTTTACCGGTTTACTTA Sez_1303
Streptococcus pneumoniae TIGR4
Position: -253
Score: 5.03919
Position: -71
Score: 5.62835
Locus tag: SP_0320
Name: kduD
Funciton: 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase (EC
Locus tag: SP_0319
Name: kduI
Funciton: 5-keto-4-deoxyuronate isomerase (EC
Locus tag: SP_0318
Name: kdgK
Funciton: 2-dehydro-3-deoxygluconate kinase (EC
Locus tag: SP_0317
Name: kdgA
Funciton: 2-dehydro-3-deoxyphosphogluconate aldolase (EC
kduD-kduI-kdgK-kdgA -253 5 TAGGTTTACCGGTTTACTTT SP_0320
Streptococcus pyogenes M1 GAS
Position: -74
Score: 5.11186
Position: -45
Score: 6.0807
Locus tag: SPy0636
Name: kduD
Funciton: 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase (EC
Locus tag: SPy0637
Name: kduI
Funciton: 5-keto-4-deoxyuronate isomerase (EC
Locus tag: SPy0638
Name: kdgK
Funciton: 2-dehydro-3-deoxygluconate kinase (EC
Locus tag: SPy0639
Name: kdgA
Funciton: 2-dehydro-3-deoxyphosphogluconate aldolase (EC
kduD-kduI-kdgK-kdgA -74 5.1 TGACAAAACTAGTTTACTTT SPy0636
Streptococcus suis 05ZYH33
Position: -75
Score: 5.82847
Locus tag: SSU05_1225
Name: kduD
Funciton: 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase (EC
Locus tag: SSU05_1224
Name: kduI
Funciton: 5-keto-4-deoxyuronate isomerase (EC
Locus tag: SSU05_1223
Name: kdgK
Funciton: 2-dehydro-3-deoxygluconate kinase (EC
Locus tag: SSU05_1222
Name: kdgA
Funciton: 2-dehydro-3-deoxyphosphogluconate aldolase (EC
kduD-kduI-kdgK-kdgA -75 5.8 TGACAAAACCGGTTTACTAT SSU05_1225