Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing hylF gene

Properties
Regulog: RegR - Streptococcaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Hyaluronate utilization
Effector: Hyaluronate oligosaccharide phosphate
Phylum: Firmicutes
Built upon 27 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Streptococcus agalactiae 2603V/R
Position: -251
Score: 5.09009
Sequence: GAAGTAAACCTGTTTACATG
Position: -222
Score: 5.85934
Sequence: AAAGTAAACCGGTTTTGTCA
Position: -32
Score: 5.12804
Sequence: AAAGTAAACCGGTAAACTCA
Locus tag: SAG1902
Name: hylD
Funciton: PTS system, hyaluronate-oligosaccharide-specific IIA component (EC 2.7.1.69)
Locus tag: SAG1901
Name: ugl
Funciton: Unsaturated glucuronyl hydrolase (EC 3.2.1.-)
Locus tag: SAG1900
Name: hylE
Funciton: PTS system, hyaluronate-oligosaccharide-specific IIB component (EC 2.7.1.69)
Locus tag: SAG1899
Name: hylF
Funciton: PTS system, hyaluronate-oligosaccharide-specific IIC component (EC 2.7.1.69)
Locus tag: SAG1898
Name: hylG
Funciton: PTS system, hyaluronate-oligosaccharide-specific IID component (EC 2.7.1.69)
Locus tag: SAG1897
Name: ohl
Funciton: Oligohyaluronate lyase (EC 4.2.2.-)
Locus tag: SAG1896
Name: regR
Funciton: Transcriptional regulator of hyaluronate and KDG utilization, LacI family
hylD-ugl-hylE-hylF-hylG-ohl-regR -251 5.1 GAAGTAAACCTGTTTACATG SAG1902
-222 5.9 AAAGTAAACCGGTTTTGTCA
-32 5.1 AAAGTAAACCGGTAAACTCA
Streptococcus equi subsp. zooepidemicus MGCS10565
Position: -281
Score: 6.0807
Sequence: TAAGTAAACCTGTTTACCAA
Position: -33
Score: 5.3494
Sequence: TAAGTAAACCGGTAAACTAA
Locus tag: Sez_1304
Name: hylD
Funciton: PTS system, hyaluronate-oligosaccharide-specific IIA component (EC 2.7.1.69)
Locus tag: Sez_1305
Name: ugl
Funciton: Unsaturated glucuronyl hydrolase (EC 3.2.1.-)
Locus tag: Sez_1306
Name: hylE
Funciton: PTS system, hyaluronate-oligosaccharide-specific IIB component (EC 2.7.1.69)
Locus tag: Sez_1307
Name: hylF
Funciton: PTS system, hyaluronate-oligosaccharide-specific IIC component (EC 2.7.1.69)
Locus tag: Sez_1308
Name: hylG
Funciton: PTS system, hyaluronate-oligosaccharide-specific IID component (EC 2.7.1.69)
hylD-ugl-hylE-hylF-hylG -281 6.1 TAAGTAAACCTGTTTACCAA Sez_1304
-33 5.3 TAAGTAAACCGGTAAACTAA
Streptococcus pneumoniae TIGR4
Position: -219
Score: 5.62835
Sequence: CTAGTAAACCGGTTTTGTCA
Position: -37
Score: 5.03919
Sequence: AAAGTAAACCGGTAAACCTA
Locus tag: SP_0321
Name: hylD
Funciton: PTS system, hyaluronate-oligosaccharide-specific IIA component (EC 2.7.1.69)
Locus tag: SP_0322
Name: ugl
Funciton: Unsaturated glucuronyl hydrolase (EC 3.2.1.-)
Locus tag: SP_0323
Name: hylE
Funciton: PTS system, hyaluronate-oligosaccharide-specific IIB component (EC 2.7.1.69)
Locus tag: SP_0324
Name: hylF
Funciton: PTS system, hyaluronate-oligosaccharide-specific IIC component (EC 2.7.1.69)
Locus tag: SP_0325
Name: hylG
Funciton: PTS system, hyaluronate-oligosaccharide-specific IID component (EC 2.7.1.69)
Locus tag: SP_0326
Name: yajC
Funciton: Preprotein translocase subunit YajC (TC 3.A.5.1.1)
Locus tag: SP_0327
Name: ohl
Funciton: Oligohyaluronate lyase (EC 4.2.2.-)
Locus tag: SP_0328
Name: null
Funciton: IS1380-Spn1, transposase
Locus tag: SP_0329
Name: ohl
Funciton: Oligohyaluronate lyase (EC 4.2.2.-)
Locus tag: SP_0330
Name: regR
Funciton: Transcriptional regulator of hyaluronate and KDG utilization, LacI family
hylD-ugl-hylE-hylF-hylG-yajC-ohl-SP_0328-ohl-regR -219 5.6 CTAGTAAACCGGTTTTGTCA SP_0321
-37 5 AAAGTAAACCGGTAAACCTA
Streptococcus pyogenes M1 GAS
Position: -281
Score: 5.11186
Sequence: AAAGTAAACTAGTTTTGTCA
Position: -33
Score: 4.6043
Sequence: TGAGTAAACCGGTAAACCGA
Locus tag: SPy0634
Name: hylD
Funciton: PTS system, hyaluronate-oligosaccharide-specific IIA component (EC 2.7.1.69)
Locus tag: SPy0632
Name: ugl
Funciton: Unsaturated glucuronyl hydrolase (EC 3.2.1.-)
Locus tag: SPy0631
Name: hylE
Funciton: PTS system, hyaluronate-oligosaccharide-specific IIB component (EC 2.7.1.69)
Locus tag: SPy0630
Name: hylF
Funciton: PTS system, hyaluronate-oligosaccharide-specific IIC component (EC 2.7.1.69)
Locus tag: SPy0629
Name: hylG
Funciton: PTS system, hyaluronate-oligosaccharide-specific IID component (EC 2.7.1.69)
Locus tag: SPy0628
Name: ohl
Funciton: Oligohyaluronate lyase (EC 4.2.2.-)
Locus tag: SPy0627
Name: regR
Funciton: Transcriptional regulator of hyaluronate and KDG utilization, LacI family
hylD-ugl-hylE-hylF-hylG-ohl-regR -281 5.1 AAAGTAAACTAGTTTTGTCA SPy0634
-33 4.6 TGAGTAAACCGGTAAACCGA
Streptococcus suis 05ZYH33
Position: -33
Score: 4.91289
Sequence: TAGGTAAACCGGTAAAGTTA
Locus tag: SSU05_1221
Name: hylD
Funciton: PTS system, hyaluronate-oligosaccharide-specific IIA component (EC 2.7.1.69)
Locus tag: SSU05_1220
Name: ugl
Funciton: Unsaturated glucuronyl hydrolase (EC 3.2.1.-)
Locus tag: SSU05_1219
Name: hylE
Funciton: PTS system, hyaluronate-oligosaccharide-specific IIB component (EC 2.7.1.69)
Locus tag: SSU05_1218
Name: hylF
Funciton: PTS system, hyaluronate-oligosaccharide-specific IIC component (EC 2.7.1.69)
Locus tag: SSU05_1217
Name: hylG
Funciton: PTS system, hyaluronate-oligosaccharide-specific IID component (EC 2.7.1.69)
Locus tag: SSU05_1216
Name: yajC
Funciton: Preprotein translocase subunit YajC (TC 3.A.5.1.1)
Locus tag: SSU05_1215
Name: hyl
Funciton: Hyaluronate lyase precursor (EC 4.2.2.1)
Locus tag: SSU05_1214
Name: hyl
Funciton: Hyaluronate lyase precursor (EC 4.2.2.1)
Locus tag: SSU05_1213
Name: hyl
Funciton: Hyaluronate lyase precursor (EC 4.2.2.1)
Locus tag: SSU05_1212
Name: hyl
Funciton: Hyaluronate lyase precursor (EC 4.2.2.1)
hylD-ugl-hylE-hylF-hylG-yajC-hyl-hyl-hyl-hyl -33 4.9 TAGGTAAACCGGTAAAGTTA SSU05_1221