Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing livK gene

Regulog: PaaR - Comamonadaceae
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Phenylacetic acid degradation
Effector: Phenylacetyl-CoA
Phylum: Betaproteobacteria
Built upon 13 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Delftia acidovorans SPH-1
Position: -71
Score: 5.20424
Locus tag: Daci_0568
Name: paaF
Funciton: Enoyl-CoA hydratase (EC
Locus tag: Daci_0569
Name: paaY
Funciton: thioesterase superfamily protein
Locus tag: Daci_0570
Name: paaK
Funciton: Phenylacetate-coenzyme A ligase (EC
Locus tag: Daci_0571
Name: paaR
Funciton: Transcriptional regulator of phenylacetic acid degradation, TetR family
Locus tag: Daci_0572
Name: livK
Funciton: Putative branched-chain amino acid ABC transporter, substrate-binding component
Locus tag: Daci_0573
Name: livH
Funciton: Putative branched-chain amino acid ABC transporter, permease component
Locus tag: Daci_0574
Name: livM
Funciton: Putative branched-chain amino acid ABC transporter, ATPase component
Locus tag: Daci_0575
Name: livF
Funciton: Putative branched-chain amino acid ABC transporter, permease component 2
paaF-paaY-paaK-paaR-livK-livH-livM-livF -71 5.2 ATTTACCGACCATTCGGTAAAT Daci_0568
Leptothrix cholodnii SP-6
Position: -42
Score: 5.76971
Locus tag: Lcho_2405
Name: paaF
Funciton: Enoyl-CoA hydratase (EC
Locus tag: Lcho_2404
Name: paaY
Funciton: thioesterase superfamily protein
Locus tag: Lcho_2403
Name: paaK
Funciton: Phenylacetate-coenzyme A ligase (EC
Locus tag: Lcho_2402
Name: paaR
Funciton: Transcriptional regulator of phenylacetic acid degradation, TetR family
Locus tag: Lcho_2401
Name: livK
Funciton: Putative branched-chain amino acid ABC transporter, substrate-binding component
paaF-paaY-paaK-paaR-livK -42 5.8 ATTTACCTACCGGTCGGTCAAG Lcho_2405
Variovorax paradoxus S110
Position: -52
Score: 4.62868
Position: -48
Score: 5.49521
Locus tag: Vapar_1238
Name: paaF
Funciton: Enoyl-CoA hydratase (EC
Locus tag: Vapar_1237
Name: paaY
Funciton: thioesterase superfamily protein
Locus tag: Vapar_1236
Name: paaK
Funciton: Phenylacetate-coenzyme A ligase (EC
Locus tag: Vapar_1235
Name: paaA
Funciton: Phenylacetate-CoA oxygenase, PaaA subunit
Locus tag: Vapar_1234
Name: paaB
Funciton: Phenylacetate-CoA oxygenase, PaaB subunit
Locus tag: Vapar_1233
Name: paaC
Funciton: Phenylacetate-CoA oxygenase, PaaC subunit
Locus tag: Vapar_1232
Name: paaD
Funciton: Phenylacetate-CoA oxygenase, PaaD subunit
Locus tag: Vapar_1231
Name: paaE
Funciton: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
Locus tag: Vapar_1230
Name: livK
Funciton: Putative branched-chain amino acid ABC transporter, substrate-binding component
Locus tag: Vapar_1229
Name: livH
Funciton: Putative branched-chain amino acid ABC transporter, permease component
Locus tag: Vapar_1228
Name: livM
Funciton: Putative branched-chain amino acid ABC transporter, ATPase component
Locus tag: Vapar_1227
Name: livF
Funciton: Putative branched-chain amino acid ABC transporter, permease component 2
Locus tag: Vapar_1226
Name: paaZ
Funciton: Aldehyde dehydrogenase (EC, PaaZ
paaF-paaY-paaK-paaA-paaB-paaC-paaD-paaE-livK-livH-livM-livF-paaZ -52 4.6 TAAAATCTACCGGACGGTCGGT Vapar_1238
Verminephrobacter eiseniae EF01-2
Position: -102
Score: 5.49521
Locus tag: Veis_3942
Name: paaF
Funciton: Enoyl-CoA hydratase (EC
Locus tag: Veis_3943
Name: paaY
Funciton: thioesterase superfamily protein
Locus tag: Veis_3944
Name: paaK
Funciton: Phenylacetate-coenzyme A ligase (EC
Locus tag: Veis_3945
Name: paaA
Funciton: Phenylacetate-CoA oxygenase, PaaA subunit
Locus tag: Veis_3946
Name: paaB
Funciton: Phenylacetate-CoA oxygenase, PaaB subunit
Locus tag: Veis_3947
Name: paaC
Funciton: Phenylacetate-CoA oxygenase, PaaC subunit
Locus tag: Veis_3948
Name: paaD
Funciton: Phenylacetate-CoA oxygenase, PaaD subunit
Locus tag: Veis_3949
Name: paaE
Funciton: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
Locus tag: Veis_3950
Name: paaR
Funciton: Transcriptional regulator of phenylacetic acid degradation, TetR family
Locus tag: Veis_3951
Name: livK
Funciton: Putative branched-chain amino acid ABC transporter, substrate-binding component
Locus tag: Veis_3952
Name: livH
Funciton: Putative branched-chain amino acid ABC transporter, permease component
Locus tag: Veis_3953
Name: livM
Funciton: Putative branched-chain amino acid ABC transporter, ATPase component
paaF-paaY-paaK-paaA-paaB-paaC-paaD-paaE-paaR-livK-livH-livM -102 5.5 ATCTACCGCACGGTCGGTCAAT Veis_3942