Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing paaR gene

Properties
Regulog: PaaR - Comamonadaceae
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Phenylacetic acid degradation
Effector: Phenylacetyl-CoA
Phylum: Betaproteobacteria
Built upon 13 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Leptothrix cholodnii SP-6
Position: -42
Score: 5.76971
Sequence: ATTTACCTACCGGTCGGTCAAG
Locus tag: Lcho_2405
Name: paaF
Funciton: Enoyl-CoA hydratase (EC 4.2.1.17)
Locus tag: Lcho_2404
Name: paaY
Funciton: thioesterase superfamily protein
Locus tag: Lcho_2403
Name: paaK
Funciton: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
Locus tag: Lcho_2402
Name: paaR
Funciton: Transcriptional regulator of phenylacetic acid degradation, TetR family
Locus tag: Lcho_2401
Name: livK
Funciton: Putative branched-chain amino acid ABC transporter, substrate-binding component
paaF-paaY-paaK-paaR-livK -42 5.8 ATTTACCTACCGGTCGGTCAAG Lcho_2405
Methylibium petroleiphilum PM1
Position: -85
Score: 5.66643
Sequence: GTCTACCGACTGGTCGGTCAAT
Locus tag: Mpe_A0984
Name: paaF
Funciton: Enoyl-CoA hydratase (EC 4.2.1.17)
Locus tag: Mpe_A0985
Name: paaY
Funciton: thioesterase superfamily protein
Locus tag: Mpe_A0986
Name: paaK
Funciton: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
Locus tag: Mpe_A0987
Name: paaA
Funciton: Phenylacetate-CoA oxygenase, PaaA subunit
Locus tag: Mpe_A0988
Name: paaB
Funciton: Phenylacetate-CoA oxygenase, PaaB subunit
Locus tag: Mpe_A0989
Name: paaC
Funciton: Phenylacetate-CoA oxygenase, PaaC subunit
Locus tag: Mpe_A0990
Name: paaD
Funciton: Phenylacetate-CoA oxygenase, PaaD subunit
Locus tag: Mpe_A0991
Name: paaE
Funciton: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
Locus tag: Mpe_A0992
Name: paaR
Funciton: Transcriptional regulator of phenylacetic acid degradation, TetR family
paaF-paaY-paaK-paaA-paaB-paaC-paaD-paaE-paaR -85 5.7 GTCTACCGACTGGTCGGTCAAT Mpe_A0984
Variovorax paradoxus S110
Position: -101
Score: 5.43112
Sequence: ATTGACCGACCGTCCGGTAGAT
Locus tag: Vapar_1239
Name: paaY2
Funciton: phenylacetic acid degradation protein PaaY
Locus tag: Vapar_1240
Name: paaR
Funciton: Transcriptional regulator of phenylacetic acid degradation, TetR family
paaY2-paaR -101 5.4 ATTGACCGACCGTCCGGTAGAT Vapar_1239
Verminephrobacter eiseniae EF01-2
Position: -102
Score: 5.49521
Sequence: ATCTACCGCACGGTCGGTCAAT
Locus tag: Veis_3942
Name: paaF
Funciton: Enoyl-CoA hydratase (EC 4.2.1.17)
Locus tag: Veis_3943
Name: paaY
Funciton: thioesterase superfamily protein
Locus tag: Veis_3944
Name: paaK
Funciton: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
Locus tag: Veis_3945
Name: paaA
Funciton: Phenylacetate-CoA oxygenase, PaaA subunit
Locus tag: Veis_3946
Name: paaB
Funciton: Phenylacetate-CoA oxygenase, PaaB subunit
Locus tag: Veis_3947
Name: paaC
Funciton: Phenylacetate-CoA oxygenase, PaaC subunit
Locus tag: Veis_3948
Name: paaD
Funciton: Phenylacetate-CoA oxygenase, PaaD subunit
Locus tag: Veis_3949
Name: paaE
Funciton: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
Locus tag: Veis_3950
Name: paaR
Funciton: Transcriptional regulator of phenylacetic acid degradation, TetR family
Locus tag: Veis_3951
Name: livK
Funciton: Putative branched-chain amino acid ABC transporter, substrate-binding component
Locus tag: Veis_3952
Name: livH
Funciton: Putative branched-chain amino acid ABC transporter, permease component
Locus tag: Veis_3953
Name: livM
Funciton: Putative branched-chain amino acid ABC transporter, ATPase component
paaF-paaY-paaK-paaA-paaB-paaC-paaD-paaE-paaR-livK-livH-livM -102 5.5 ATCTACCGCACGGTCGGTCAAT Veis_3942