Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing Lcho_0276 gene

Properties
Regulog: PaaR - Comamonadaceae
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Phenylacetic acid degradation
Effector: Phenylacetyl-CoA
Phylum: Betaproteobacteria
Built upon 13 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Leptothrix cholodnii SP-6
Position: -48
Score: 6.29162
Sequence: ATTTACCGACCGGACGGTCAAT
Locus tag: Lcho_3574
Name: paaA
Funciton: Phenylacetate-CoA oxygenase, PaaA subunit
Locus tag: Lcho_3573
Name: paaB
Funciton: Phenylacetate-CoA oxygenase, PaaB subunit
Locus tag: Lcho_3572
Name: paaC
Funciton: Phenylacetate-CoA oxygenase, PaaC subunit
Locus tag: Lcho_3571
Name: paaD
Funciton: Phenylacetate-CoA oxygenase, PaaD subunit
Locus tag: Lcho_3570
Name: null
Funciton: hypothetical protein
Locus tag: Lcho_3569
Name: paaE
Funciton: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
Locus tag: Lcho_3568
Name: paaZ
Funciton: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
paaA-paaB-paaC-paaD-Lcho_3570-paaE-paaZ -48 6.3 ATTTACCGACCGGACGGTCAAT Lcho_3574