Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing paaY2 gene

Properties
Regulog: PaaR - Comamonadaceae
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Phenylacetic acid degradation
Effector: Phenylacetyl-CoA
Phylum: Betaproteobacteria
Built upon 13 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Leptothrix cholodnii SP-6
Position: -115
Score: 5.54802
Sequence: CTTGACCGACCGGTAGGTAAAT
Locus tag: Lcho_2406
Name: paaY2
Funciton: phenylacetic acid degradation protein PaaY
paaY2 -115 5.5 CTTGACCGACCGGTAGGTAAAT Lcho_2406
Methylibium petroleiphilum PM1
Position: -78
Score: 5.58326
Sequence: ATTGACCGACCAGTCGGTAGAC
Locus tag: Mpe_A0983
Name: paaY2
Funciton: phenylacetic acid degradation protein PaaY
paaY2 -78 5.6 ATTGACCGACCAGTCGGTAGAC Mpe_A0983
Variovorax paradoxus S110
Position: -101
Score: 5.43112
Sequence: ATTGACCGACCGTCCGGTAGAT
Locus tag: Vapar_1239
Name: paaY2
Funciton: phenylacetic acid degradation protein PaaY
Locus tag: Vapar_1240
Name: paaR
Funciton: Transcriptional regulator of phenylacetic acid degradation, TetR family
paaY2-paaR -101 5.4 ATTGACCGACCGTCCGGTAGAT Vapar_1239