Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing cg1831 gene

Properties
Regulog: Cg1831 - Corynebacteriaceae
Regulator type: Transcription factor
Regulator family: ArsR
Regulation mode: repressor
Biological process: Iron homeostasis
Effector:
Phylum: Actinobacteria
Built upon 4 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Corynebacterium efficiens YS-314
Position: 8
Score: 5.94376
Sequence: ACTCAATCACCCGTTTGACT
Locus tag: CE2678
Name: cg1831
Funciton: Predicted Fe-siderophore transport transcriptional regulator, MerR family
cg1831 8 5.9 ACTCAATCACCCGTTTGACT CE2678
Corynebacterium glutamicum ATCC 13032
Position: -40
Score: 6.52683
Sequence: ACTCAAATGATCATTTGACT
Locus tag: cg1831
Name: cg1831
Funciton: Predicted Fe-siderophore transport transcriptional regulator, MerR family
cg1831 -40 6.5 ACTCAAATGATCATTTGACT cg1831