Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing tctC gene

Regulog: CitB - Corynebacteriaceae
Regulator type: Transcription factor
Regulator family: CitB
Regulation mode: activator
Biological process: Citrate utilization
Effector: Citrate
Phylum: Actinobacteria
Built upon 5 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Corynebacterium glutamicum ATCC 13032
Position: -43
Score: 5.14334
Locus tag: cg3127
Name: tctC
Funciton: Citrate TTT family transporter, subunit C
Locus tag: cg3126
Name: tctB
Funciton: Citrate TTT family transporter, subunit B
Locus tag: cg3125
Name: tctA
Funciton: Citrate TTT family transporter, subunit A
tctC-tctB-tctA -43 5.1 GAGCTTGTTGTCCAAAAGTC cg3127