Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing citA gene

Regulog: CitB - Corynebacteriaceae
Regulator type: Transcription factor
Regulator family: CitB
Regulation mode: activator
Biological process: Citrate utilization
Effector: Citrate
Phylum: Actinobacteria
Built upon 5 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Corynebacterium efficiens YS-314
Position: -81
Score: 5.7749
Locus tag: CE2905
Name: citA
Funciton: Citrate transport regulation two-component system histidine kinase
Locus tag: CE2904
Name: citB
Funciton: Citrate transport regulation two-component system response regulator, LuxR family
Corynebacterium glutamicum ATCC 13032
Position: -80
Score: 5.24241
Locus tag: cg0089
Name: citA
Funciton: Citrate transport regulation two-component system histidine kinase
Locus tag: cg0090
Name: citB
Funciton: Citrate transport regulation two-component system response regulator, LuxR family
citA-citB -80 5.2 GACTTTTGTGCATTATGATC cg0089