Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing citH gene

Properties
Regulog: CitB - Corynebacteriaceae
Regulator type: Transcription factor
Regulator family: CitB
Regulation mode: activator
Biological process: Citrate utilization
Effector: Citrate
Phylum: Actinobacteria
Built upon 5 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Corynebacterium efficiens YS-314
Position: -35
Score: 6.00283
Sequence: GAACTAAATGCACTTAATTC
Locus tag: CE2906
Name: citH
Funciton: Citrate transporter
citH -35 6 GAACTAAATGCACTTAATTC CE2906
Corynebacterium glutamicum ATCC 13032
Position: -148
Score: 5.70863
Sequence: GATCATAATGCACAAAAGTC
Locus tag: cg0088
Name: citH
Funciton: Citrate transporter
citH -148 5.7 GATCATAATGCACAAAAGTC cg0088