Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing xapX gene

Properties
Regulog: XapR - Enterobacteriales
Regulator type: Transcription factor
Regulator family: LysR
Regulation mode: activator
Biological process: Xanthosine utilization
Effector: Deoxyinosine; Xanthosine
Phylum: Proteobacteria/gamma
Built upon 5 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Edwardsiella tarda EIB202
Position: -115
Score: 4.36517
Sequence: TCCCTAGCAAATCAATACTGA
Locus tag: ETAE_2779
Name: xapA
Funciton: Xanthosine phosphorylase (EC 2.4.2.1)
Locus tag: ETAE_2780
Name: xapX
Funciton: Predicted xanthosine transporter
Locus tag: ETAE_2781
Name: xapR
Funciton: Xanthosine operon regulatory protein XapR, LysR family
xapA-xapX-xapR -115 4.4 TCCCTAGCAAATCAATACTGA ETAE_2779