Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing xapB gene

Properties
Regulog: XapR - Enterobacteriales
Regulator type: Transcription factor
Regulator family: LysR
Regulation mode: activator
Biological process: Xanthosine utilization
Effector: Deoxyinosine; Xanthosine
Phylum: Proteobacteria/gamma
Built upon 5 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Citrobacter koseri ATCC BAA-895
Position: -120
Score: 6.23346
Sequence: TCAATATACATTTTATATCGA
Locus tag: CKO_00389
Name: xapA
Funciton: Xanthosine phosphorylase (EC 2.4.2.1)
Locus tag: CKO_00390
Name: xapB
Funciton: Xanthosine permease
Locus tag: CKO_00391
Name: xapR
Funciton: Xanthosine operon regulatory protein XapR, LysR family
xapA-xapB-xapR -120 6.2 TCAATATACATTTTATATCGA CKO_00389
Enterobacter sp. 638
Position: -121
Score: 5.16572
Sequence: TTGATACTGAAAGAGTATTGA
Locus tag: Ent638_2934
Name: xapA
Funciton: Xanthosine phosphorylase (EC 2.4.2.1)
Locus tag: Ent638_2933
Name: xapB
Funciton: Xanthosine permease
Locus tag: Ent638_2932
Name: xapR
Funciton: Xanthosine operon regulatory protein XapR, LysR family
xapA-xapB-xapR -121 5.2 TTGATACTGAAAGAGTATTGA Ent638_2934
Escherichia coli str. K-12 substr. MG1655
Position: -132
Score: 4.22582
Sequence: TTAATAGAGAAAAGATATAAA
Position: -107
Score: 5.91526
Sequence: TCGATATCGAATCGCTATTGA
Locus tag: b2407
Name: xapA
Funciton: Xanthosine phosphorylase (EC 2.4.2.1)
Locus tag: b2406
Name: xapB
Funciton: Xanthosine permease
xapA-xapB -132 4.2 TTAATAGAGAAAAGATATAAA b2407
-107 5.9 TCGATATCGAATCGCTATTGA