Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing agl4 gene

Properties
Regulog: ScrR - Lactobacillaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sucrose utilization
Effector: Sucrose-6-phosphate
Phylum: Firmicutes
Built upon 24 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Lactobacillus plantarum WCFS1
Position: -171
Score: 6.00893
Sequence: TATGTCAAGCGTTTGATACA
Position: -82
Score: 6.42881
Sequence: AATGTCAAACGATTGACATA
Locus tag: lp_0187
Name: scrB
Funciton: Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
Locus tag: lp_0188
Name: scrR
Funciton: Sucrose utilization transcriptional regulator ScrR, LacI family
Locus tag: lp_0189
Name: agl4
Funciton: Oligo-1,6-glucosidase (EC 3.2.1.10)
scrB-scrR-agl4 -171 6 TATGTCAAGCGTTTGATACA lp_0187
-82 6.4 AATGTCAAACGATTGACATA
Pediococcus pentosaceus ATCC 25745
Position: -171
Score: 6.00893
Sequence: TATGTCAAGCGTTTGATACA
Position: -82
Score: 6.42881
Sequence: AATGTCAAACGATTGACATA
Locus tag: PEPE_0519
Name: scrB
Funciton: Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
Locus tag: PEPE_0520
Name: scrR
Funciton: Sucrose utilization transcriptional regulator ScrR, LacI family
Locus tag: PEPE_0521
Name: agl4
Funciton: Oligo-1,6-glucosidase (EC 3.2.1.10)
scrB-scrR-agl4 -171 6 TATGTCAAGCGTTTGATACA PEPE_0519
-82 6.4 AATGTCAAACGATTGACATA