Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing scrB gene

Properties
Regulog: ScrR - Lactobacillaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sucrose utilization
Effector: Sucrose-6-phosphate
Phylum: Firmicutes
Built upon 24 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Lactobacillus acidophilus NCFM
Position: -168
Score: 6.39299
Sequence: TATGTCAATCGTTTGACACA
Position: -80
Score: 6.2351
Sequence: TATGATAAACGTTTGACACA
Locus tag: LBA0400
Name: scrB
Funciton: Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
Locus tag: LBA0399
Name: scrR
Funciton: Sucrose utilization transcriptional regulator ScrR, LacI family
scrB-scrR -168 6.4 TATGTCAATCGTTTGACACA LBA0400
-80 6.2 TATGATAAACGTTTGACACA
Lactobacillus fermentum IFO 3956
Position: -73
Score: 5.47862
Sequence: TATGCTAATCGATTGACAGC
Locus tag: LAF_1580
Name: scrB
Funciton: Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
scrB -73 5.5 TATGCTAATCGATTGACAGC LAF_1580
Lactobacillus johnsonii NCC 533
Position: -164
Score: 5.93716
Sequence: TATGTCAAGCGCTTATCATA
Position: -87
Score: 5.27266
Sequence: ACTGTTATTCGTTTGACATA
Locus tag: LJ0518
Name: scrB
Funciton: Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
Locus tag: LJ0517
Name: scrR
Funciton: Sucrose utilization transcriptional regulator ScrR, LacI family
scrB-scrR -164 5.9 TATGTCAAGCGCTTATCATA LJ0518
-87 5.3 ACTGTTATTCGTTTGACATA
Lactobacillus plantarum WCFS1
Position: -171
Score: 6.00893
Sequence: TATGTCAAGCGTTTGATACA
Position: -82
Score: 6.42881
Sequence: AATGTCAAACGATTGACATA
Locus tag: lp_0187
Name: scrB
Funciton: Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
Locus tag: lp_0188
Name: scrR
Funciton: Sucrose utilization transcriptional regulator ScrR, LacI family
Locus tag: lp_0189
Name: agl4
Funciton: Oligo-1,6-glucosidase (EC 3.2.1.10)
scrB-scrR-agl4 -171 6 TATGTCAAGCGTTTGATACA lp_0187
-82 6.4 AATGTCAAACGATTGACATA
Lactobacillus sakei subsp. sakei 23K
Position: -145
Score: 6.23871
Sequence: TATGTCAAACGATTATCATA
Position: -77
Score: 5.93797
Sequence: AATGACATACGTTTGACATA
Locus tag: LSA1793
Name: scrB
Funciton: Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
Locus tag: LSA1794
Name: scrR
Funciton: Sucrose utilization transcriptional regulator ScrR, LacI family
scrB-scrR -145 6.2 TATGTCAAACGATTATCATA LSA1793
-77 5.9 AATGACATACGTTTGACATA
Lactobacillus salivarius subsp. salivarius UCC118
Position: -81
Score: 5.85375
Sequence: TATGTTATACGATTGACAGT
Locus tag: LSL_0065
Name: scrB
Funciton: Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
Locus tag: LSL_0064
Name: scrR
Funciton: Sucrose utilization transcriptional regulator ScrR, LacI family
scrB-scrR -81 5.9 TATGTTATACGATTGACAGT LSL_0065
Pediococcus pentosaceus ATCC 25745
Position: -171
Score: 6.00893
Sequence: TATGTCAAGCGTTTGATACA
Position: -82
Score: 6.42881
Sequence: AATGTCAAACGATTGACATA
Locus tag: PEPE_0519
Name: scrB
Funciton: Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
Locus tag: PEPE_0520
Name: scrR
Funciton: Sucrose utilization transcriptional regulator ScrR, LacI family
Locus tag: PEPE_0521
Name: agl4
Funciton: Oligo-1,6-glucosidase (EC 3.2.1.10)
scrB-scrR-agl4 -171 6 TATGTCAAGCGTTTGATACA PEPE_0519
-82 6.4 AATGTCAAACGATTGACATA